GediPNet logo

TREH (trehalase)
Gene
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
11181
Gene nameGene Name - the full gene name approved by the HGNC.
Trehalase
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
TREH
SynonymsGene synonyms aliases
TRE, TREA, TREHD
ChromosomeChromosome number
11
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
11q23.3
SummarySummary of gene provided in NCBI Entrez Gene.
This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript varia
SNPsSNP information provided by dbSNP.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
SNP ID Visualize variation Clinical significance Consequence
rs527655595 GTGGCAGTAAATCTCACTGCAGAGAC>- Conflicting-interpretations-of-pathogenicity Splice acceptor variant, coding sequence variant, intron variant
miRNAmiRNA information provided by mirtarbase database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
miRTarBase ID miRNA Experiments Reference
MIRT017846 hsa-miR-335-5p Microarray 18185580
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
GO ID Ontology Definition Evidence Reference
GO:0004555 Function Alpha,alpha-trehalase activity IDA 8773341, 9427547
GO:0005991 Process Trehalose metabolic process NAS 8773341
GO:0005993 Process Trehalose catabolic process IDA 9427547
GO:0009887 Process Animal organ morphogenesis IEA
GO:0031225 Component Anchored component of membrane ISS
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
MIM
HGNC
e!Ensembl
Protein
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
UniProt ID O43280
Protein name Trehalase (EC 3.2.1.28) (Alpha,alpha-trehalase) (Alpha,alpha-trehalose glucohydrolase)
Protein function Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose.
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF01204 Trehalase
46 → 551
Trehalase
 Domain
Sequence
Sequence length 583
Interactions View interactions
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
 
KEGG
  
  Starch and sucrose metabolism
Metabolic pathways 		 
Associated diseases
Gene SNPs miRNA Gene ontology Other IDs Protein Pathways Associated diseases
Causal
Disease name Disease term dbSNP ID References
Glioma Glioma rs121909219, rs121909224, rs587776667, rs587776671, rs121909239, rs121909241, rs28933368, rs121913500, rs55863639, rs786201995, rs786202517, rs786201044, rs398123317, rs1057518425, rs121913499, rs1060500122, rs781647403, rs1060500126, rs1554897889, rs1114167629, rs1114167656, rs587782603, rs1554893824, rs1554900615, rs1564568660, rs786204900, rs762518389, rs1339631701 19578367, 21531791
Unknown
Disease name Disease term dbSNP ID References
Trehalase deficiency Trehalase deficiency rs527655595

| © 2021, Biomedical Informatics Centre, NIRRH |
ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400012
Tel: +91-22-24192104, Fax No: +91-22-24139412