Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
10345 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Triadin |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
TRDN |
SynonymsGene synonyms aliases
|
CARDAR, CPVT5, TDN, TRISK |
ChromosomeChromosome number
|
6 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
6q22.31 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanod |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs200243235 |
T>C |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant, genic downstream transcript variant |
rs202219343 |
G>A,C |
Likely-pathogenic, pathogenic, uncertain-significance |
Coding sequence variant, stop gained, missense variant, genic downstream transcript variant |
rs377115913 |
C>A,T |
Likely-pathogenic |
Splice donor variant, genic downstream transcript variant |
rs397515458 |
G>A |
Pathogenic |
Stop gained, coding sequence variant, genic downstream transcript variant |
rs578024729 |
T>C |
Pathogenic |
Genic downstream transcript variant, splice acceptor variant |
rs747836980 |
A>C |
Pathogenic |
Stop gained, coding sequence variant, genic downstream transcript variant |
rs750469686 |
TCTT>- |
Pathogenic, likely-pathogenic |
Frameshift variant, coding sequence variant, genic downstream transcript variant |
rs778198100 |
->CT |
Likely-pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs781420323 |
TT>- |
Pathogenic |
Genic downstream transcript variant, frameshift variant, coding sequence variant |
rs1060502114 |
C>- |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1085307100 |
->T |
Likely-pathogenic, pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1298986609 |
C>T |
Likely-pathogenic |
Genic downstream transcript variant, splice acceptor variant |
rs1381728472 |
T>- |
Pathogenic |
Coding sequence variant, genic downstream transcript variant, frameshift variant |
rs1468290898 |
T>A |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, stop gained |
rs1554251609 |
->C |
Pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
rs1562358749 |
GGCATGAAATGGGAGCCAGTAGGCTGGGAGCAAGGTGAGAGGAAGGTTTTCACAAAGTATCTTTATGTGTTGAGCAATTAGAACTTATTATCTATTCTACATAAATAAATAACAATTAGAAATTAAAGCAATCTAATAGATAATCAAAATATGCAAGTTATAATAATGAGATCTACTTTCTTACCTATCAAACTGACAAGTATTTCTGATATAATATCCTCACTGCTGGCTAAGGCAGTCTCAAAACTGCCAGAG |
Likely-pathogenic |
Splice donor variant, genic downstream transcript variant, coding sequence variant, intron variant |
rs1582923790 |
CT>- |
Likely-pathogenic |
Genic downstream transcript variant, coding sequence variant, frameshift variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0005102 |
Function |
Signaling receptor binding |
IEA |
|
GO:0005515 |
Function |
Protein binding |
IPI |
17526652 |
GO:0005783 |
Component |
Endoplasmic reticulum |
ISS |
|
GO:0005829 |
Component |
Cytosol |
IDA |
|
GO:0005886 |
Component |
Plasma membrane |
IBA |
21873635 |
GO:0005886 |
Component |
Plasma membrane |
IDA |
|
GO:0006874 |
Process |
Cellular calcium ion homeostasis |
ISS |
|
GO:0006936 |
Process |
Muscle contraction |
TAS |
7588753 |
GO:0009617 |
Process |
Response to bacterium |
IEA |
|
GO:0010649 |
Process |
Regulation of cell communication by electrical coupling |
TAS |
19567751 |
GO:0010880 |
Process |
Regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum |
IBA |
21873635 |
GO:0010880 |
Process |
Regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum |
ISS |
|
GO:0014701 |
Component |
Junctional sarcoplasmic reticulum membrane |
IBA |
21873635 |
GO:0014701 |
Component |
Junctional sarcoplasmic reticulum membrane |
ISS |
|
GO:0014701 |
Component |
Junctional sarcoplasmic reticulum membrane |
TAS |
17569730 |
GO:0014808 |
Process |
Release of sequestered calcium ion into cytosol by sarcoplasmic reticulum |
ISS |
|
GO:0016021 |
Component |
Integral component of membrane |
IEA |
|
GO:0016529 |
Component |
Sarcoplasmic reticulum |
ISS |
|
GO:0030314 |
Component |
Junctional membrane complex |
ISS |
|
GO:0030674 |
Function |
Protein-macromolecule adaptor activity |
ISS |
|
GO:0031122 |
Process |
Cytoplasmic microtubule organization |
ISS |
|
GO:0033017 |
Component |
Sarcoplasmic reticulum membrane |
TAS |
11504710 |
GO:0033018 |
Component |
Sarcoplasmic reticulum lumen |
TAS |
17569730 |
GO:0034220 |
Process |
Ion transmembrane transport |
TAS |
|
GO:0044325 |
Function |
Ion channel binding |
IBA |
21873635 |
GO:0044325 |
Function |
Ion channel binding |
ISS |
|
GO:0051279 |
Process |
Regulation of release of sequestered calcium ion into cytosol |
TAS |
19567751 |
GO:0060047 |
Process |
Heart contraction |
IBA |
21873635 |
GO:0060047 |
Process |
Heart contraction |
IMP |
22422768 |
GO:0060315 |
Process |
Negative regulation of ryanodine-sensitive calcium-release channel activity |
TAS |
17569730 |
GO:0060316 |
Process |
Positive regulation of ryanodine-sensitive calcium-release channel activity |
IBA |
21873635 |
GO:0060316 |
Process |
Positive regulation of ryanodine-sensitive calcium-release channel activity |
ISS |
|
GO:0060316 |
Process |
Positive regulation of ryanodine-sensitive calcium-release channel activity |
TAS |
19567751 |
GO:0086036 |
Process |
Regulation of cardiac muscle cell membrane potential |
IBA |
21873635 |
GO:0086036 |
Process |
Regulation of cardiac muscle cell membrane potential |
ISS |
|
GO:0090158 |
Process |
Endoplasmic reticulum membrane organization |
ISS |
|
GO:1901846 |
Process |
Positive regulation of cell communication by electrical coupling involved in cardiac conduction |
ISS |
|
GO:1903779 |
Process |
Regulation of cardiac conduction |
TAS |
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q13061 |
Protein name |
Triadin |
Protein function |
Contributes to the regulation of lumenal Ca2+ release via the sarcoplasmic reticulum calcium release channels RYR1 and RYR2, a key step in triggering skeletal and heart muscle contraction. Required for normal organization of the triad junction, |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF05279 |
Asp-B-Hydro_N |
42 → 269 |
Aspartyl beta-hydroxylase N-terminal region |
Family |
|
Sequence |
|
Sequence length |
729 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Catecholaminergic polymorphic ventricular tachycardia |
VENTRICULAR TACHYCARDIA, CATECHOLAMINERGIC POLYMORPHIC, 1 (disorder), Catecholaminergic polymorphic ventricular tachycardia |
rs121918597, rs121918598, rs121918599, rs121918600, rs121918601, rs121918602, rs121918603, rs121918604, rs121918605, rs121434549, rs786205106, rs121434550, rs267607276, rs267607277, rs397507555, rs397507556, rs397516508, rs397516539, rs397516643, rs768049331, rs397515458, rs397515459, rs730880187, rs730880201, rs1553191909, rs139228801, rs786205791, rs786205799, rs794728706, rs794728708, rs190140598, rs794728721, rs794728740, rs794728746, rs794728753, rs794728754, rs794728756, rs794728704, rs794728777, rs794728779, rs794728782, rs794728783, rs794728785, rs771994461, rs794728786, rs794728787, rs794728803, rs794728804, rs794728810, rs794728811, rs794728832, rs763955301, rs1085307100, rs876657635, rs886037908, rs886037907, rs1057517699, rs773204795, rs1060502164, rs1060500142, rs1060500156, rs1060500150, rs1060500137, rs1060502114, rs1060502116, rs1064796516, rs1085307997, rs776874142, rs1436844070, rs1553322494, rs1553197939, rs1553343100, rs752256846, rs865784613, rs1553454821, rs1553426678, rs1415931588, rs1553263875, rs794728802, rs1553339086, rs1554258777, rs756636650, rs905985075, rs1401116572, rs1553339084, rs1553531703, rs1554251609, rs1558405887, rs1558698334, rs1558393802, rs1558405816, rs397516510, rs1558481148, rs1558424746, rs1558103974, rs1558381851, rs1558405653, rs1468290898, rs1573911397, rs1471576368, rs375598471, rs1342435908, rs1573300872, rs1209752961, rs1573887621, rs1226397753, rs1573911593, rs1573935244, rs765238394, rs1185619003, rs1573997412, rs775663612, rs958406908, rs754834466, rs749547712, rs1682400034, rs1658967336, rs545032318, rs1695315646, rs1663792524 |
26200674, 22422768, 25922419 |
Diabetes mellitus |
Diabetes Mellitus, Insulin-Dependent, Diabetes Mellitus, Non-Insulin-Dependent |
rs587776515, rs61730328, rs606231121, rs606231122, rs79020217, rs77625743, rs78378398, rs606231123, rs4402960, rs1362648752, rs3745368, rs3792267, rs3842570, rs5030952, rs2975760, rs119489103, rs7903146, rs12255372, rs11196205, rs104893649, rs80356624, rs80356616, rs80356625, rs80356611, rs104894237, rs80356613, rs137852740, rs137852786, rs387906407, rs151344623, rs28938469, rs28936371, rs137852672, rs80356637, rs80356642, rs80356653, rs137852673, rs137852674, rs80356634, rs80356651, rs193929360, rs137853334, rs137853335, rs137853336, rs1600731198, rs137853338, rs121964882, rs121964883, rs387906511, rs121964884, rs121964885, rs2147483647, rs387906512, rs121964887, rs121964888, rs121964889, rs121964890, rs121964891, rs28934878, rs74315383, rs121964893, rs886037620, rs886037621, rs80356663, rs121434593, rs121913150, rs587776825, rs137853236, rs2135842335, rs137853237, rs137853238, rs2135818776, rs1566092470, rs1463923467, rs137853243, rs137853244, rs2135839114, rs137853245, rs2135847417, rs121918407, rs104894005, rs104894006, rs80356655, rs104894008, rs104894009, rs104894010, rs104894011, rs80356654, rs104894016, rs193929376, rs193929374, rs193929375, rs193929373, rs80356666, rs80356669, rs80356664, rs193929366, rs1048095, rs193929355, rs193929356, rs1259467443, rs104893642, rs387906777, rs387906779, rs141804752, rs182349376, rs184917682, rs193922396, rs193922400, rs193922401, rs137852676, rs193922407, rs193922638, rs193922257, rs193922258, rs193922259, rs193922260, rs193922261, rs193922262, rs193922263, rs193922264, rs193922265, rs193922268, rs193921338, rs193922269, rs193922272, rs193922273, rs193922275, rs193922278, rs193922279, rs193922280, rs193922281, rs193922282, rs193922283, rs193922284, rs193922286, rs193922287, rs193922289, rs193922291, rs193922295, rs193922297, rs193922300, rs193922302, rs193922303, rs193922308, rs193922313, rs193922314, rs144723656, rs193922315, rs193922316, rs193922317, rs148311934, rs193922319, rs193922320, rs193922326, rs193922329, rs193922330, rs193922331, rs193922335, rs193922336, rs193922338, rs193922340, rs193922341, rs193922471, rs193922475, rs193922476, rs193922479, rs193922355, rs193922356, rs193922576, rs193922578, rs193922582, rs193922588, rs193922592, rs193922594, rs193922596, rs386134267, rs193922598, rs193922599, rs193922600, rs193922604, rs193922605, rs397514580, rs397515519, rs267601516, rs587780343, rs587780345, rs587780346, rs587780347, rs587780357, rs148954387, rs61736969, rs587783673, rs587783672, rs587783669, rs786204676, rs794727236, rs151344624, rs794727775, rs794727839, rs199946797, rs869320673, rs796065047, rs759072800, rs797045595, rs797045209, rs797045207, rs797045213, rs797045623, rs863225280, rs149703259, rs864321656, rs139964066, rs777870079, rs878853246, rs769268803, rs886039380, rs886041392, rs886041391, rs886042610, rs143064649, rs1057516192, rs746480424, rs1057516281, rs576684889, rs754728827, rs1057520291, rs1057520779, rs893256143, rs1057520504, rs1057524790, rs1057524902, rs1057524904, rs1057524905, rs764232985, rs1064793998, rs1064794268, rs769086289, rs369429452, rs1085307913, rs1131691416, rs765432081, rs1131692182, rs748749585, rs1554335441, rs762263694, rs1312678560, rs767565869, rs1375656631, rs1554335391, rs1360415315, rs1554335616, rs1554335752, rs1554909277, rs769518471, rs757171524, rs768951263, rs762703502, rs1555212248, rs1555212359, rs1555813319, rs1555816654, rs1553638903, rs1553638909, rs948820149, rs371977235, rs1553784995, rs76474829, rs200998587, rs1415041911, rs1554334894, rs1260178539, rs1554335421, rs1555211904, rs779184183, rs1554335564, rs200670692, rs1400535021, rs1554334872, rs1555212749, rs1553876668, rs1553878211, rs954727530, rs1554924035, rs372307320, rs925231098, rs1554913069, rs1554933565, rs766431403, rs746714109, rs751279984, rs770664202, rs1008906426, rs758844607, rs1554924540, rs1566092307, rs753998395, rs1565885935, rs1167124132, rs1376796469, rs556436603, rs1562715657, rs1486280029, rs1564869850, rs755259997, rs769569410, rs1172328722, rs1286294151, rs1375557127, rs1568731279, rs1562715426, rs556581174, rs1564865302, rs1565886545, rs776793516, rs1568724014, rs1392795567, rs781260712, rs1562719705, rs1382448285, rs1564977373, rs750586210, rs1598842892, rs1583592247, rs780612692, rs1593060859, rs1476637197, rs751279776, rs1593060890, rs1191912908, rs1167675604, rs1583601110, rs1593058932, rs778611627, rs753296261 |
28672053 |
Dysautonomia |
Dysautonomia |
rs111033171, rs137853022, rs28939712, rs754348901, rs749052963, rs1057517169, rs1057516865, rs763445509, rs767527819, rs781333644, rs1239081703, rs1554696574, rs539544212, rs1201626345, rs774890086, rs1554703061, rs1554703613, rs1319053366, rs1554703851, rs868073099, rs926177767, rs376078668, rs1554695299, rs1554696648, rs1554696934, rs1554699327, rs1554691572, rs1554695846, rs1554697001, rs770668926, rs1554698037, rs759412460, rs1554702142, rs765572951, rs1554702880, rs1554703831, rs760774999, rs1554696650, rs757972943, rs1554703874, rs1554703907, rs571348995 |
|
Neuropathy |
Neuropathy, NEUROPATHY, CONGENITAL HYPOMYELINATING, 2, NEUROPATHY, CONGENITAL HYPOMYELINATING, 3 |
rs121913593, rs121913595, rs751050956, rs878853221, rs768554986, rs1553259568, rs1567973091, rs1560046845, rs1567969825, rs1567973088, rs756896276 |
28672053 |
Ventricular tachycardia |
Tachycardia, Ventricular, Ventricular tachycardia, polymorphic |
rs137853228, rs397517025, rs199473373, rs727504432, rs1450434935, rs1592847299 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Diabetic foot |
Diabetic Foot |
|
28672053 |
Heart failure |
Heart Failure, Diastolic |
rs121918074, rs142027794, rs148791216, rs72648927, rs71578935, rs142416150, rs199830512, rs755445214, rs150102469, rs779568205, rs907992794, rs1202130741 |
29556499 |
Hereditary and idiopathic neuropathy |
Hereditary and idiopathic neuropathy, unspecified |
|
28672053 |
Romano-ward syndrome |
Romano-Ward Syndrome |
|
27041150 |
Torsades de pointes |
Torsades de Pointes |
rs36210421, rs36210419, rs36210415, rs36210416, rs36210420 |
|
Ventricular tachycardia, with or without muscle weakness |
VENTRICULAR TACHYCARDIA, CATECHOLAMINERGIC POLYMORPHIC, 5, WITH OR WITHOUT MUSCLE WEAKNESS |
|
26200674, 22422768, 28202702 |
|
|
|