SIGMAR1 (sigma non-opioid intracellular receptor 1)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
10280 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Sigma non-opioid intracellular receptor 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SIGMAR1 |
SynonymsGene synonyms aliases
|
ALS16, DSMA2, HMNR2, OPRS1, SIG-1R, SR-BP, SR-BP1, SRBP, hSigmaR1, sigma1R |
ChromosomeChromosome number
|
9 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
9p13.3 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs387906829 |
C>G,T |
Pathogenic |
Intron variant, synonymous variant, missense variant, coding sequence variant |
rs747285235 |
G>- |
Pathogenic |
Non coding transcript variant, 5 prime UTR variant, coding sequence variant, frameshift variant |
rs780136067 |
->G |
Pathogenic |
Coding sequence variant, intron variant, frameshift variant |
rs796065352 |
C>A |
Pathogenic |
Splice donor variant, intron variant |
rs1270528470 |
C>A,T |
Likely-pathogenic |
Coding sequence variant, missense variant, intron variant, non coding transcript variant |
rs1554707622 |
GCTCCTGTCTATCCGCAGGTCTTCCTTCAGGCCTGGCTGGTCAAGGGTCCTGGCCAAAGAGGTAGGTGGTGAGCTCAAGCCGGAGGCCCCGAGCATAGGAGCGAAGAGTATAGAAGAGGGTGAGGAAGTCCTGGGTGCTGAAGACAGTGTCGGCCAGCGCGAAGGCCAGGGTGGATGGGATGACGCCCCGGCCGTACTCCACCATCCATGTGTTTGGCCCCCACTCCACAGCTGTTGCCTCACCAGGCCCGTGTA |
Likely-pathogenic |
Splice acceptor variant, terminator codon variant, non coding transcript variant, 3 prime UTR variant, intron variant |
rs1554707680 |
TGAAGACAGTGTCGGC>- |
Likely-pathogenic |
Non coding transcript variant, coding sequence variant, frameshift variant, intron variant, 3 prime UTR variant |
rs1564096221 |
G>A |
Pathogenic |
5 prime UTR variant, non coding transcript variant, coding sequence variant, stop gained |
rs1564096761 |
C>- |
Pathogenic |
5 prime UTR variant, non coding transcript variant, coding sequence variant, frameshift variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Transcription factors
|
Transcription factor |
Regulation |
Reference |
ATF4 |
Activation |
22079628 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q99720 |
Protein name |
Sigma non-opioid intracellular receptor 1 (Aging-associated gene 8 protein) (SR31747-binding protein) (SR-BP) (Sigma 1-type opioid receptor) (SIG-1R) (Sigma1-receptor) (Sigma1R) (hSigmaR1) |
Protein function |
Functions in lipid transport from the endoplasmic reticulum and is involved in a wide array of cellular functions probably through regulation of the biogenesis of lipid microdomains at the plasma membrane. Involved in the regulation of different |
PDB |
5HK1
,
5HK2
,
6DJZ
,
6DK0
,
6DK1
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF04622 |
ERG2_Sigma1R |
12 → 217 |
ERG2 and Sigma1 receptor like protein |
Family |
|
Sequence |
|
Sequence length |
223 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Amyotrophic lateral sclerosis |
Amyotrophic Lateral Sclerosis, Amyotrophic Lateral Sclerosis, Guam Form, AMYOTROPHIC LATERAL SCLEROSIS 16, JUVENILE, Juvenile amyotrophic lateral sclerosis |
rs267607084, rs312262720, rs312262752, rs121908287, rs121908288, rs29001584, rs28941475, rs121434378, rs386134173, rs386134174, rs80356730, rs80356727, rs4884357, rs80356717, rs80356733, rs80356731, rs80356726, rs267606928, rs267606929, rs1885090126, rs121434591, rs121912431, rs121912432, rs121912433, rs121912434, rs121912435, rs121912440, rs121912436, rs121912437, rs121912438, rs121912439, rs74315452, rs121912442, rs121912443, rs121912444, rs121912446, rs121912447, rs1197141604, rs121912448, rs121912449, rs121912450, rs121912451, rs121912452, rs121912453, rs121912454, rs369600566, rs121912455, rs121912456, rs121912457, rs121912458, rs1555836889, rs121909667, rs121909668, rs121909669, rs121909671, rs121909535, rs121909537, rs121909538, rs121909539, rs121909540, rs121909542, rs121909544, rs80356734, rs367543041, rs80356740, rs80356719, rs80356721, rs80356723, rs80356725, rs387906627, rs387906628, rs387906709, rs387906710, rs387906711, rs387906829, rs387907264, rs387907265, rs387907266, rs312262739, rs312262709, rs312262749, rs200793464, rs147713329, rs312262788, rs397514262, rs63751180, rs587777132, rs730880025, rs730880026, rs730880027, rs368743618, rs730880029, rs730882255, rs730882256, rs786205611, rs121912441, rs199947197, rs780136067, rs772731615, rs879253926, rs879254294, rs764717219, rs886041390, rs750159428, rs753207473, rs267607087, rs767350733, rs778305085, rs1554707680, rs1554707622, rs1393363759, rs750959420, rs1555509569, rs1554716504, rs11556620, rs1247392012, rs142083484, rs140385286, rs749428135, rs371575563, rs1402429085, rs1218712729, rs1555179091, rs1555179087, rs746971952, rs1555836950, rs368276916, rs140376902, rs747220413, rs76731700, rs770684782, rs1200906022, rs1804449, rs1482760341, rs769898852, rs140599944, rs757972700, rs1555451521, rs1592362719, rs1555836803, rs763455928, rs1378590183, rs1583695322, rs1362178149, rs1197928094, rs368751524, rs1555509609, rs1574787779, rs1601157750, rs1301635320, rs1341055534, rs1402092579, rs1568809172, rs1555836170, rs1315541036, rs1339283341, rs1643659556, rs1644506661, rs1435710212, rs1553122918, rs1689580631, rs374047961, rs775935265, rs2076486420, rs1820836522, rs757260058, rs1844420892, rs1833371664, rs1833438306, rs1833451208, rs2083790483, rs1303294230, rs1226110412, rs2053207945, rs2053208751, rs2053501632, rs2053539304, rs1567479067, rs544088874, rs1228194239, rs1568807400, rs1169198442, rs2049594204, rs2049594311, rs1568810641, rs1568811372, rs2049618449, rs1476760624, rs2079347087 |
24885036, 21842496, 27821430, 26078401, 26633545, 21842496, 24085347 |
Distal hereditary motor neuronopathy |
Distal hereditary motor neuropathy, Jerash type |
rs104894345, rs104894351, rs137852970, rs137852972, rs267607143, rs267607145, rs28939680, rs29001571, rs28937568, rs28937569, rs104894020, rs121909112, rs121909113, rs121909342, rs786205090, rs137852644, rs137852646, rs121913595, rs387906904, rs387907242, rs398123028, rs398122838, rs730880031, rs730882139, rs730882140, rs267607623, rs797044802, rs746581714, rs756614404, rs770272088, rs876661124, rs879253868, rs879254085, rs764813110, rs1060502838, rs1064796370, rs1554338260, rs137852973, rs1347223331, rs377626365, rs772217003, rs1553174566, rs1324667543, rs557327165, rs1441260635, rs1565929080, rs770593694, rs1584026191, rs372181708, rs758322672, rs1587668798, rs1587671674, rs972425138, rs1594427564, rs1594445698, rs1594453111, rs1337346956, rs1240319744, rs199839840, rs754422011, rs1595599240, rs1595600898, rs1555408333, rs774079947, rs1584034430, rs562669797, rs749383814, rs762573767, rs767263669, rs746212067, rs1182614290, rs1018405924 |
|
Frontotemporal dementia |
Frontotemporal Lobar Degeneration |
rs63751273, rs63750376, rs63750424, rs63750972, rs1568327531, rs63750570, rs63750756, rs63751165, rs63750512, rs63751438, rs63750912, rs63750711, rs63750635, rs63750349, rs63750092, rs63749801, rs63751399, rs199476352, rs63751035, rs63749974, rs63750568, rs63750013, rs63751394, rs63750308, rs63751011, rs63750095, rs794729672, rs794729669, rs63749817, rs794729670, rs193026789, rs794729671, rs1085307051, rs1566630811, rs1566630884, rs1567885658, rs1567886206, rs1567886445, rs1567886478, rs1567887015, rs1567887777, rs1567888461, rs1566630791, rs1598408073, rs1570725499, rs1598408336 |
24885036 |
Schizophrenia |
Schizophrenia |
rs74315508, rs74315509, rs13447324, rs1558507406, rs387906932, rs387906933, rs863223354, rs863223355, rs776061422, rs863223349, rs748809996, rs759748655, rs863223353, rs863223350, rs863223356, rs781821239, rs863223348, rs863223346, rs863223347, rs863223351, rs863223352, rs61734270, rs797045205, rs869312829, rs869312830, rs770913157, rs869312832, rs869312831, rs781720548, rs1262969313 |
15298647, 21549171, 19439245, 14567761 |
Seizure |
Complex partial seizures, Generalized seizures, Visual seizure, Tonic - clonic seizures, Single Seizure |
rs587784365, rs28939683, rs74315390, rs28939684, rs74315391, rs267607198, rs74315392, rs118192244, rs118192250, rs121917749, rs121917750, rs121917751, rs121917752, rs267606670, rs267607061, rs121912707, rs118192249, rs118192251, rs118192217, rs118192218, rs118192219, rs118192222, rs118192226, rs118192228, rs118192234, rs118192236, rs118192235, rs118192241, rs118192242, rs118192185, rs118192188, rs118192245, rs118192246, rs118192186, rs118192194, rs118192197, rs118192199, rs118192201, rs118192202, rs118192203, rs118192204, rs118192205, rs118192206, rs118192208, rs118192211, rs118192216, rs118192239, rs387906684, rs387906686, rs387906687, rs1596893185, rs387907126, rs387907281, rs397515405, rs587778771, rs730882067, rs730882073, rs397514579, rs397514582, rs587776976, rs398122394, rs121918784, rs121918751, rs121918735, rs398123588, rs587780450, rs61749751, rs587777620, rs727503974, rs730882124, rs794726710, rs794726697, rs794726799, rs794727444, rs794727740, rs796053166, rs794726825, rs796052676, rs796053219, rs796053220, rs796053228, rs796052653, rs759584387, rs796052650, rs796052641, rs796052626, rs796052623, rs796052663, rs796052615, rs796052802, rs797044999, rs797045047, rs797045942, rs797045941, rs118192212, rs797044938, rs777257591, rs864321712, rs879255652, rs886039268, rs886039517, rs886039529, rs199497486, rs886039496, rs886039903, rs886041300, rs769827124, rs886041339, rs886041591, rs587783092, rs1555850151, rs1057516123, rs1057516121, rs1057516115, rs1057516111, rs1057516106, rs1057516105, rs756921902, rs1057516089, rs1057516087, rs1057516080, rs1057516076, rs1060499544, rs1555850512, rs1057517919, rs118192231, rs1057520413, rs1060503101, rs1064796294, rs1064794981, rs1064794632, rs1064797245, rs1131691830, rs1131692231, rs1131691936, rs1554626549, rs1553579225, rs1553531385, rs121918736, rs1554898088, rs1553579282, rs763353895, rs1553463119, rs1554093891, rs77838305, rs1555408401, rs1554627439, rs1554097873, rs1555850403, rs1064794719, rs1315483224, rs1567134495, rs770187706, rs1057518555, rs1576983339, rs1574192005, rs1459374430, rs1586800133, rs1574641522, rs1572096837, rs1572630269, rs1574554892, rs1574556643, rs1574571769, rs1574641605, rs1574697769, rs1574716524, rs1574746733, rs1574746935, rs1574752700, rs1574754680, rs863225030, rs1601545088, rs1600714727, rs1371059392, rs1600767259, rs1339542565, rs1600785769, rs2065899210, rs1600732174, rs1162306056, rs879255709, rs1900111672, rs2066910297, rs1554122080, rs796052941, rs1600789325, rs2082695884, rs1737677036, rs1737495759, rs868389022, rs1737685202, rs1737672350, rs762737130 |
11684152 |
Spinal muscular atrophy |
Spinal Muscular Atrophy, Spinal muscular atrophy, Jerash type |
rs104893922, rs1554066397, rs77804083, rs104893930, rs104893927, rs104893935, rs387906738, rs398123028, rs371707778, rs398123030, rs587780564, rs713993043, rs727505393, rs797044855, rs863223361, rs797045412, rs869320621, rs879254085, rs1057518083, rs1064795760, rs1131691347, rs1554082383, rs1554338262, rs1561503058, rs1564061982, rs141760116, rs1217001154, rs1561498701, rs77668214, rs1587671674, rs972425138, rs1595599240, rs1587668077, rs1587668748, rs1587668769, rs1263279945, rs1889019962 |
26078401, 27629094 |
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Amnesia |
Amnesia |
|
12028363 |
Amyotrophic lateral sclerosis with dementia |
Amyotrophic Lateral Sclerosis With Dementia |
|
24885036 |
Clonic seizures |
Clonic Seizures |
|
11684152 |
Distal amyotrophy |
Distal amyotrophy |
rs1457770815 |
|
Dysarthria |
Dysarthria |
|
|
Hypotonic seizures |
Epileptic drop attack |
|
11684152 |
Jacksonian seizure |
Jacksonian Seizure |
|
11684152 |
Learning disorders |
Learning Disorders, Adult Learning Disorders, Learning Disturbance, Learning Disabilities |
|
15451042 |
Memory disorders |
Memory Disorders |
|
15451042 |
Age-related memory disorders |
Age-Related Memory Disorders |
|
15451042 |
Mood disorder |
Mood Disorders |
|
15635598 |
Sensory neuropathy |
Sensory neuropathy |
|
|
|
|
|