ZMPSTE24 (zinc metallopeptidase STE24)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
10269 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Zinc metallopeptidase STE24 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ZMPSTE24 |
SynonymsGene synonyms aliases
|
FACE-1, FACE1, HGPS, PRO1, RSDM1, STE24, Ste24p |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1p34.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutat |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs61751009 |
G>A |
Pathogenic |
Splice acceptor variant |
rs121908093 |
T>C |
Pathogenic, not-provided |
Non coding transcript variant, missense variant, coding sequence variant |
rs121908094 |
C>T |
Pathogenic, not-provided |
Stop gained, non coding transcript variant, coding sequence variant |
rs121908095 |
C>G,T |
Pathogenic, not-provided |
Non coding transcript variant, missense variant, coding sequence variant |
rs137854889 |
T>-,TT |
Pathogenic |
Non coding transcript variant, frameshift variant, coding sequence variant |
rs150740479 |
A>G |
Conflicting-interpretations-of-pathogenicity |
Synonymous variant, coding sequence variant, non coding transcript variant |
rs267607181 |
G>A,T |
Pathogenic, not-provided |
Non coding transcript variant, missense variant, coding sequence variant, stop gained |
rs281875360 |
A>- |
Pathogenic |
Non coding transcript variant, coding sequence variant, frameshift variant |
rs281875361 |
->T |
Pathogenic, not-provided |
Non coding transcript variant, coding sequence variant, frameshift variant |
rs281875367 |
->T |
Pathogenic, not-provided |
Non coding transcript variant, coding sequence variant, frameshift variant |
rs281875375 |
->T |
Pathogenic |
Non coding transcript variant, coding sequence variant, frameshift variant |
rs281875376 |
G>A |
Pathogenic, not-provided |
Non coding transcript variant, coding sequence variant, stop gained |
rs750229142 |
G>A |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, non coding transcript variant, synonymous variant |
rs786205123 |
AT>- |
Pathogenic |
Coding sequence variant, frameshift variant, non coding transcript variant |
rs886044057 |
A>- |
Pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
rs1431637197 |
T>A,G |
Pathogenic |
Non coding transcript variant, stop gained, coding sequence variant |
rs1569668526 |
TTCTAGATGAATTCTTTCCTGTGTTTTTTTTT>- |
Pathogenic |
Intron variant, non coding transcript variant, splice acceptor variant, coding sequence variant |
rs1569671504 |
->T |
Likely-pathogenic |
Frameshift variant, non coding transcript variant, coding sequence variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0001889 |
Process |
Liver development |
IEA |
|
GO:0001942 |
Process |
Hair follicle development |
IEA |
|
GO:0003007 |
Process |
Heart morphogenesis |
IEA |
|
GO:0003229 |
Process |
Ventricular cardiac muscle tissue development |
IEA |
|
GO:0003231 |
Process |
Cardiac ventricle development |
IEA |
|
GO:0003417 |
Process |
Growth plate cartilage development |
IEA |
|
GO:0003690 |
Function |
Double-stranded DNA binding |
IEA |
|
GO:0004222 |
Function |
Metalloendopeptidase activity |
IBA |
21873635 |
GO:0005515 |
Function |
Protein binding |
IPI |
23539603, 28169297 |
GO:0005637 |
Component |
Nuclear inner membrane |
IEA |
|
GO:0006281 |
Process |
DNA repair |
IEA |
|
GO:0006508 |
Process |
Proteolysis |
TAS |
10373325 |
GO:0006925 |
Process |
Inflammatory cell apoptotic process |
IEA |
|
GO:0006998 |
Process |
Nuclear envelope organization |
IEA |
|
GO:0007628 |
Process |
Adult walking behavior |
IEA |
|
GO:0008235 |
Function |
Metalloexopeptidase activity |
TAS |
10373325 |
GO:0008340 |
Process |
Determination of adult lifespan |
IEA |
|
GO:0008360 |
Process |
Regulation of cell shape |
IEA |
|
GO:0010506 |
Process |
Regulation of autophagy |
IEA |
|
GO:0010906 |
Process |
Regulation of glucose metabolic process |
IEA |
|
GO:0016020 |
Component |
Membrane |
HDA |
19946888 |
GO:0019216 |
Process |
Regulation of lipid metabolic process |
IEA |
|
GO:0030176 |
Component |
Integral component of endoplasmic reticulum membrane |
IBA |
21873635 |
GO:0030282 |
Process |
Bone mineralization |
IEA |
|
GO:0030327 |
Process |
Prenylated protein catabolic process |
IEA |
|
GO:0030500 |
Process |
Regulation of bone mineralization |
IEA |
|
GO:0032006 |
Process |
Regulation of TOR signaling |
IEA |
|
GO:0032350 |
Process |
Regulation of hormone metabolic process |
IEA |
|
GO:0032991 |
Component |
Protein-containing complex |
IDA |
28246125 |
GO:0035264 |
Process |
Multicellular organism growth |
IEA |
|
GO:0040014 |
Process |
Regulation of multicellular organism growth |
IEA |
|
GO:0043007 |
Process |
Maintenance of rDNA |
IEA |
|
GO:0043516 |
Process |
Regulation of DNA damage response, signal transduction by p53 class mediator |
IEA |
|
GO:0043979 |
Process |
Histone H2B-K5 acetylation |
IEA |
|
GO:0044029 |
Process |
Hypomethylation of CpG island |
IEA |
|
GO:0044255 |
Process |
Cellular lipid metabolic process |
IEA |
|
GO:0046872 |
Function |
Metal ion binding |
IEA |
|
GO:0048145 |
Process |
Regulation of fibroblast proliferation |
IEA |
|
GO:0048538 |
Process |
Thymus development |
IEA |
|
GO:0048739 |
Process |
Cardiac muscle fiber development |
IEA |
|
GO:0050688 |
Process |
Regulation of defense response to virus |
IDA |
28246125 |
GO:0050905 |
Process |
Neuromuscular process |
IEA |
|
GO:0060307 |
Process |
Regulation of ventricular cardiac muscle cell membrane repolarization |
IEA |
|
GO:0060993 |
Process |
Kidney morphogenesis |
IEA |
|
GO:0061337 |
Process |
Cardiac conduction |
IEA |
|
GO:0061762 |
Process |
CAMKK-AMPK signaling cascade |
IEA |
|
GO:0070062 |
Component |
Extracellular exosome |
HDA |
19056867 |
GO:0070302 |
Process |
Regulation of stress-activated protein kinase signaling cascade |
IEA |
|
GO:0071480 |
Process |
Cellular response to gamma radiation |
IEA |
|
GO:0071586 |
Process |
CAAX-box protein processing |
IBA |
21873635 |
GO:0072423 |
Process |
Response to DNA damage checkpoint signaling |
IEA |
|
GO:1903025 |
Process |
Regulation of RNA polymerase II regulatory region sequence-specific DNA binding |
IEA |
|
GO:1903463 |
Process |
Regulation of mitotic cell cycle DNA replication |
IEA |
|
GO:1903799 |
Process |
Negative regulation of production of miRNAs involved in gene silencing by miRNA |
IEA |
|
GO:1990036 |
Process |
Calcium ion import into sarcoplasmic reticulum |
IEA |
|
GO:1990164 |
Process |
Histone H2A phosphorylation |
IEA |
|
GO:2000618 |
Process |
Regulation of histone H4-K16 acetylation |
IEA |
|
GO:2000730 |
Process |
Regulation of termination of RNA polymerase I transcription |
IEA |
|
GO:2000772 |
Process |
Regulation of cellular senescence |
IEA |
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
O75844 |
Protein name |
CAAX prenyl protease 1 homolog (EC 3.4.24.84) (Farnesylated proteins-converting enzyme 1) (FACE-1) (Prenyl protein-specific endoprotease 1) (Zinc metalloproteinase Ste24 homolog) |
Protein function |
Transmembrane metalloprotease whose catalytic activity is critical for processing lamin A/LMNA on the inner nuclear membrane and clearing clogged translocons on the endoplasmic reticulum (PubMed:33293369, PubMed:33315887). Proteolytically remove |
PDB |
2YPT
,
4AW6
,
5SYT
,
6BH8
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF16491 |
Peptidase_M48_N |
41 → 225 |
CAAX prenyl protease N-terminal, five membrane helices |
Domain |
PF01435 |
Peptidase_M48 |
228 → 473 |
Peptidase family M48 |
Domain |
|
Sequence |
|
Sequence length |
475 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Arthritis |
Degenerative polyarthritis |
rs1594890601, rs1594882933, rs184370809, rs776489319, rs1594883470 |
|
Arthrogryposis multiplex congenita |
Arthrogryposis |
rs1586285494, rs80358233, rs137853305, rs1559154278, rs398124167, rs398124172, rs587780399, rs786204576, rs786204430, rs769345284, rs749355583, rs793888524, rs793888525, rs878854368, rs555445835, rs758105619, rs886041851, rs794727136, rs755239192, rs760715690, rs773952935, rs112610938, rs1057516676, rs1057516996, rs780022652, rs1057517399, rs1057517360, rs1057518353, rs1057517977, rs1064796311, rs779232987, rs775997446, rs1064797093, rs1064797094, rs1064797095, rs755500591, rs754272530, rs758247804, rs200731870, rs747179265, rs1553740233, rs776569219, rs375628303, rs775631800, rs781667543, rs1553548666, rs928945364, rs763364977, rs1458048713, rs1553883480, rs1472403020, rs1336053002, rs202048855, rs1197561990, rs755531536, rs1554112524, rs762133567, rs1553555882, rs934111355, rs1255744452, rs1366269616, rs1555734932, rs1553548207, rs752582527, rs1257495033, rs113525641, rs755863625, rs374929094, rs539819851, rs1366853918, rs1218073575, rs1553537512, rs1553552384, rs747564597, rs776059611, rs756726488, rs1357811155, rs1553939600, rs772009599, rs1255445731, rs1011425121, rs1553561697, rs1553551748, rs1553552413, rs760935667, rs1553603400, rs1302373559, rs1389892619, rs1553710982, rs757157808, rs1180339426, rs761964375, rs1235589246, rs1443738549, rs1553934586, rs1553934597, rs1553603437, rs749452641, rs1553904694, rs754369875, rs112517981, rs774495973, rs1428597732, rs746999970, rs113091511, rs1553603958, rs1553469502, rs770797137, rs1553608621, rs1159756073, rs776167256, rs778593702, rs1553601066, rs1553689774, rs760768475, rs1559296376, rs201636991, rs1559039815, rs748922882, rs772366030, rs1207534366, rs1259297878, rs762780413, rs1559360386, rs1559940778, rs760200697, rs1344099907, rs750900690, rs1559168230, rs746177326, rs761067911, rs1323364980, rs537560378, rs1319778592, rs1340063197, rs1577833924, rs750585238, rs1600470099, rs1575714905, rs1576203853, rs779909544, rs760124743, rs2096362304, rs1212374733, rs1490309743, rs767709270, rs1374971806, rs2096491549, rs2097886912, rs2099021112, rs2097758221, rs1474341248, rs925947627 |
|
Atrial septal defect |
Atrial Septal Defects |
rs137852951, rs137852953, rs137852955, rs267607106, rs104893900, rs104893901, rs104893903, rs606231358, rs606231359, rs137852683, rs606231360, rs104893907, rs104894073, rs1585703301, rs104894074, rs267606903, rs121912677, rs387906585, rs387906773, rs72554028, rs587782928, rs587782929, rs587782930, rs587784067, rs1555226315, rs879253754, rs1114167356, rs773922431, rs1554093487, rs1554093433, rs1554093461, rs1561621507, rs1561619801, rs766692577, rs1581108237, rs1581111034, rs1579663872, rs1583066622, rs1456289029, rs1761430125 |
|
Dextrocardia |
Dextrocardia |
rs1555672928 |
|
Hearing loss |
Sensorineural Hearing Loss (disorder) |
rs267607135, rs267606855, rs779841884, rs267606854, rs28942097, rs121908073, rs121908076, rs74315289, rs121908144, rs111033313, rs74315437, rs121908348, rs121908349, rs121908350, rs397515359, rs180177151, rs180177154, rs180177153, rs35689081, rs35887622, rs80338944, rs104894396, rs104894398, rs80338947, rs80338948, rs80338942, rs104894402, rs104894403, rs80338945, rs28931594, rs80338940, rs80338941, rs80356590, rs80338950, rs387906706, rs387906707, rs387906708, rs398122848, rs387907016, rs587776894, rs387907088, rs397515411, rs370965183, rs398122930, rs199897298, rs111033187, rs111033448, rs199606180, rs111033284, rs397516413, rs111033305, rs111033220, rs111033256, rs111033297, rs111033253, rs104894408, rs111033295, rs397516874, rs76434661, rs111033335, rs397517323, rs111033247, rs367928692, rs374793617, rs143939430, rs397515605, rs80338939, rs200656442, rs779748859, rs587781261, rs587781262, rs143343083, rs200147906, rs730880338, rs797044491, rs146281367, rs756484720, rs869025593, rs201306709, rs540895576, rs777777359, rs879255246, rs1554358720, rs142498437, rs377145777, rs1057517519, rs779077039, rs952741388, rs1060499797, rs764139009, rs1060499590, rs1064794012, rs1064797115, rs756790858, rs775633137, rs1554952443, rs1554952193, rs782063761, rs1199012623, rs756147087, rs1555648043, rs1555661490, rs1553196233, rs781546107, rs111033190, rs775428246, rs782539587, rs537227442, rs148695069, rs1554835827, rs953422571, rs1554834186, rs1554834161, rs1554835103, rs1554577339, rs1554577402, rs768471577, rs782279338, rs781951909, rs998045226, rs375759781, rs755804651, rs1557458426, rs767797828, rs538027448, rs1559366084, rs367688416, rs1558480402, rs1558490542, rs1559870857, rs1560690591, rs1561299289, rs1562817224, rs1562817529, rs1562822565, rs1562835391, rs1564113368, rs1564554255, rs773851192, rs1564555240, rs761261855, rs1564805114, rs1565522273, rs1565127413, rs781790246, rs1565430886, rs1565469959, rs746667217, rs1565819402, rs1565855932, rs150529554, rs1567939793, rs201866631, rs754472294, rs1559372512, rs1558464965, rs1558488902, rs775062249, rs1226171550, rs1561590396, rs765574676, rs762876554, rs757327146, rs1564949059, rs1565519673, rs368050948, rs1565541888, rs781989117, rs1565402473, rs750358148, rs1386887007, rs1209665716, rs1567641234, rs1237955948, rs1569042782, rs752672077, rs146689036, rs1560070780, rs149712664, rs1564556995, rs762226905, rs773573968, rs1568528171, rs1198256157, rs377267777, rs370564476, rs1577876794, rs747787770, rs759432278, rs1043716893, rs1581138934, rs2033773650, rs1421964916, rs771766431, rs780917129, rs1895773215, rs1895769400, rs761543680, rs1565920060 |
|
Hutchinson-gilford syndrome |
Hutchinson-Gilford progeria syndrome |
rs58596362, rs61064130, rs60310264, rs59886214, rs57629361, rs267607547, rs61444459, rs113436208, rs797044487, rs797044488 |
|
Hyperinsulinism |
Hyperinsulinism |
rs387906407, rs151344623, rs121913156, rs137853245, rs80356655, rs104894010, rs104894012, rs104894014, rs104894015, rs137852676, rs587783169, rs72559716, rs541269678, rs151344624, rs797045209, rs761749884, rs797045624, rs863225280, rs139964066, rs1057516281, rs1057516317, rs576684889, rs201682634, rs1350717554, rs768951263, rs1260178539, rs200670692, rs72559734, rs1400535021, rs372307320, rs1554923999, rs751279984, rs1008906426, rs367850779, rs1382448285, rs1564977373, rs750586210, rs1599937180 |
|
Hyperlipidemia |
Hyperlipidemia |
rs118204057, rs118204060, rs118204062, rs1563569634, rs118204069, rs118204070, rs118204071, rs3737787, rs2073658, rs1566946168, rs1064797075 |
|
Hypertension |
Hypertensive disease |
rs13306026, rs13333226 |
|
Hypogonadotropic hypogonadism |
Hypogonadotropic hypogonadism |
rs104894702, rs104893836, rs104893837, rs104893842, rs121909628, rs138249161, rs1601946139 |
|
Hypotrichosis |
Hypotrichosis |
rs121434306, rs121434307, rs121434308, rs121434309, rs1325804776, rs267606775, rs786200875, rs1568062215, rs267606776, rs1462595806, rs267606777, rs267606659, rs2147483647, rs559648418, rs121917819, rs121917820, rs387906382, rs267606867, rs267606868, rs267606869, rs201868115, rs587776925, rs587777527, rs587777545, rs766783183, rs879255262, rs201249971, rs768448663, rs1566212378, rs1249530918, rs1260995701, rs1569039353, rs1827030121 |
|
Insulin-resistant diabetes mellitus |
Insulin-resistant diabetes mellitus |
rs121913142 |
|
Left ventricular hypertrophy |
Left Ventricular Hypertrophy |
rs397516037 |
|
Lethal tight skin contracture syndrome |
Lethal tight skin contracture syndrome (disorder) |
rs137854889, rs267607181, rs281875361, rs281875367, rs281875360, rs786205123, rs312262686, rs1569668526 |
19020898, 15843403, 18470519 |
Lipodystrophy |
Lipodystrophy, Familial generalized lipodystrophy |
rs553668, rs766817317 |
12913070 |
Macrocephaly |
Relative macrocephaly |
rs786204854, rs764333096, rs1557739557 |
|
Mandibuloacral dysplasia with lipodystrophy |
MANDIBULOACRAL DYSPLASIA WITH TYPE B LIPODYSTROPHY |
rs137854889, rs121908093, rs121908094, rs121908095, rs56673169, rs121912494, rs281875376, rs483352811, rs312262686, rs281875369 |
17152860, 12913070, 18435794, 20814950, 15317753 |
Osteoporosis |
Osteoporosis |
rs72658152, rs72667023, rs587776916, rs72656370, rs768615287 |
|
Patent ductus arteriosus |
Patent ductus arteriosus |
rs80338911, rs879253870, rs879253871, rs879255278, rs879255279, rs879253872 |
|
Transposition of great vessels |
Transposition of Great Vessels |
rs869312707, rs1555246154, rs1565995034, rs1565995146, rs1029377279, rs1565997261, rs1566010195, rs1566005476, rs1870202051 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Acanthosis nigricans |
Acanthosis Nigricans |
rs780668 |
|
Acquired kyphoscoliosis |
Acquired Kyphoscoliosis |
|
|
Acrosteolysis |
Acro-Osteolysis |
|
17152860, 12913070 |
Adrenal hypoplasia, x-linked |
X-linked Adrenal Hypoplasia |
|
|
Alopecia |
Alopecia |
|
|
Blepharophimosis |
Blepharophimosis |
|
|
Carotid artery stenosis |
Carotid Stenosis |
|
|
Choanal atresia |
Choanal Atresia |
|
|
Clinodactyly |
Clinodactyly of fingers |
|
|
Congenital anomaly of neck |
Congenital anomaly of neck |
|
|
Short clavicles |
Congenital hypoplasia of clavicle |
|
|
Pulmonary hypoplasia |
Congenital hypoplasia of lung |
rs1569032634 |
|
Congenital kyphoscoliosis |
Congenital kyphoscoliosis |
|
|
Congenital microcephaly |
Congenital microcephaly |
|
|
Defect of skull ossification |
Defect of skull ossification |
|
|
Double ureter |
Double ureter |
|
|
Dwarfism |
Dwarfism |
|
|
Entropion |
Entropion |
|
|
Fatty liver |
Fatty Liver, Steatohepatitis |
|
|
Glomerular hyalinosis |
Hyalinosis, Segmental Glomerular |
|
17152860 |
Glomerulosclerosis |
Focal glomerulosclerosis |
|
17152860 |
High palate |
Byzanthine arch palate |
|
|
Hydropic placenta |
Hydrops of placenta |
|
|
Hyperglycemia |
Hyperglycemia |
|
|
Hyperopia |
Hyperopia |
|
|
Hyperphosphatemia |
Hyperphosphatemia (disorder) |
|
|
Hypodontia |
Hypodontia |
|
|
Hypohidrosis |
Hypohidrosis |
|
|
Hypoplasia of nipple |
Hypoplasia of nipple |
|
|
Hypoplasia of teeth |
Hypoplasia of teeth |
|
|
Hypospadias |
Hypospadias |
|
|
Keratoconjunctivitis sicca |
Keratoconjunctivitis Sicca |
|
|
Lipoatrophy |
Lipoatrophy |
|
|
Macrotia |
Macrotia |
|
|
Mandibular diseases |
Mandibular Diseases |
|
12913070 |
Maternal hypertension |
Maternal hypertension |
|
|
Microcolon |
Microcolon |
|
|
Micrognathism |
Micrognathism |
|
|
Microstomia |
Microstomia |
|
|
Microtia |
Congenital small ears |
|
|
Nail diseases |
NAIL DISORDER, NONSYNDROMIC CONGENITAL, 9 |
|
|
Nail dysplasia |
Nail dysplasia |
|
|
Nail dystrophy |
Dystrophia unguium |
|
|
Neck webbing |
Neck webbing |
|
|
Hypoglycemia |
Neonatal hypoglycemia |
|
|
Osteopenia |
Osteopenia |
|
|
Progeria |
Progeria |
|
16671095, 23217256 |
Proptosis |
Exophthalmos |
|
|
Restrictive dermopathy |
Restrictive dermopathy |
|
|
Sinus tachycardia |
Sinus Tachycardia |
|
|
Skin erosion |
Skin Erosion |
|
|
Submucosal cleft palate |
Submucous cleft of hard palate |
|
|
Temporomandibular ankylosis |
Temporomandibular ankylosis |
|
|
Thrombocytosis |
Thrombocytosis |
|
|
Transient ischemic attack |
Transient Ischemic Attack |
|
|
Vertical talus |
Vertical Talus |
|
|
|
|
|