SF3B4 (splicing factor 3b subunit 4)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
10262 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Splicing factor 3b subunit 4 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
SF3B4 |
SynonymsGene synonyms aliases
|
AFD1, Hsh49, SAP49, SF3b49 |
ChromosomeChromosome number
|
1 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
1q21.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes one of four subunits of the splicing factor 3B. The protein encoded by this gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involv |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs387907185 |
T>C |
Pathogenic |
Initiator codon variant, missense variant |
rs387907186 |
G>-,GG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs397515324 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs782357237 |
->G |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797044869 |
C>T |
Likely-pathogenic |
Splice acceptor variant |
rs797045121 |
CTCGAAG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045122 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045123 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045124 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045125 |
C>T |
Pathogenic |
Splice donor variant |
rs797045126 |
A>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045127 |
->ATACCCC |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045128 |
GGG>-,GG,GGGG |
Pathogenic |
Coding sequence variant, frameshift variant, inframe deletion |
rs797045129 |
->T |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045130 |
T>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045131 |
->TGGG |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045132 |
G>A |
Pathogenic |
Coding sequence variant, stop gained |
rs797045133 |
G>T |
Pathogenic |
Coding sequence variant, stop gained |
rs797045134 |
A>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045954 |
TCGAGGGGGAACTGGTGGCC>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045955 |
C>A |
Pathogenic |
Coding sequence variant, stop gained |
rs797045956 |
CA>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs797045957 |
CACTGGGGGTGGG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
rs886041532 |
C>- |
Pathogenic |
Frameshift variant, coding sequence variant |
rs1553765608 |
->CAGTGTA |
Pathogenic |
Coding sequence variant, frameshift variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
GO ID |
Ontology |
Definition |
Evidence |
Reference |
GO:0000375 |
Process |
RNA splicing, via transesterification reactions |
TAS |
7958871 |
GO:0000398 |
Process |
MRNA splicing, via spliceosome |
IC |
9731529 |
GO:0000398 |
Process |
MRNA splicing, via spliceosome |
IDA |
29360106 |
GO:0000398 |
Process |
MRNA splicing, via spliceosome |
TAS |
|
GO:0003723 |
Function |
RNA binding |
HDA |
22658674, 22681889 |
GO:0005515 |
Function |
Protein binding |
IPI |
16189514, 17474147, 21516116, 21988832, 22365833, 25416956, 25737013, 26871637, 29892012, 31515488, 32296183 |
GO:0005634 |
Component |
Nucleus |
IDA |
27720643, 28541300, 29360106 |
GO:0005654 |
Component |
Nucleoplasm |
TAS |
|
GO:0005681 |
Component |
Spliceosomal complex |
IDA |
9731529 |
GO:0005689 |
Component |
U12-type spliceosomal complex |
IBA |
21873635 |
GO:0005689 |
Component |
U12-type spliceosomal complex |
IDA |
15146077 |
GO:0005730 |
Component |
Nucleolus |
IBA |
21873635 |
GO:0006397 |
Process |
MRNA processing |
TAS |
7958871 |
GO:0008380 |
Process |
RNA splicing |
TAS |
7958871 |
GO:0048026 |
Process |
Positive regulation of mRNA splicing, via spliceosome |
IBA |
21873635 |
GO:0071005 |
Component |
U2-type precatalytic spliceosome |
IDA |
29360106 |
GO:1990935 |
Function |
Splicing factor binding |
IDA |
27720643, 28541300 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q15427 |
Protein name |
Splicing factor 3B subunit 4 (Pre-mRNA-splicing factor SF3b 49 kDa subunit) (Spliceosome-associated protein 49) (SAP 49) |
Protein function |
Component of the 17S U2 SnRNP complex of the spliceosome, a large ribonucleoprotein complex that removes introns from transcribed pre-mRNAs (PubMed:10882114, PubMed:12234937, PubMed:27720643, PubMed:32494006). The 17S U2 SnRNP complex (1) direct |
PDB |
1X5T
,
5GVQ
,
5Z56
,
5Z57
,
5Z58
,
6AH0
,
6AHD
,
6QX9
,
6Y53
,
6Y5Q
,
7ABG
,
7ABH
,
7ABI
,
7DVQ
,
7EVO
,
7ONB
,
7QTT
,
7VPX
,
8CH6
,
8H6E
,
8H6J
,
8H6K
,
8H6L
,
8HK1
,
8I0P
,
8I0R
,
8I0S
,
8I0T
,
8I0U
,
8I0V
,
8QO9
,
8QXD
,
8QZS
,
8R08
,
8R09
,
8R0A
,
8R0B
,
8RM5
,
8Y7E
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00076 |
RRM_1 |
15 → 85 |
RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) |
Domain |
PF00076 |
RRM_1 |
102 → 173 |
RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) |
Domain |
|
Sequence |
|
Sequence length |
424 |
Interactions |
View interactions |
PathwaysPathway information has different metabolic/signaling pathways associated with genes. Each record is hyperlinked to a complete information page which also includes links to the KEGG/Reactome pathway database.
|
|
Associated diseases
|
Causal |
Disease name |
Disease term |
dbSNP ID |
References |
Acrofacial dysostosis |
Acrofacial dysostosis Rodriguez type, Acrofacial dysostosis, Rodríguez type |
rs794729674, rs875989814, rs1064795108, rs1377622831 |
27642715 |
Hearing loss |
Conductive hearing loss |
rs267607135, rs267606855, rs779841884, rs267606854, rs28942097, rs121908073, rs121908076, rs74315289, rs121908144, rs111033313, rs74315437, rs121908348, rs121908349, rs121908350, rs397515359, rs180177151, rs180177154, rs180177153, rs35689081, rs35887622, rs80338944, rs104894396, rs104894398, rs80338947, rs80338948, rs80338942, rs104894402, rs104894403, rs80338945, rs28931594, rs80338940, rs80338941, rs80356590, rs80338950, rs387906706, rs387906707, rs387906708, rs398122848, rs387907016, rs587776894, rs387907088, rs397515411, rs370965183, rs398122930, rs199897298, rs111033187, rs111033448, rs199606180, rs111033284, rs397516413, rs111033305, rs111033220, rs111033256, rs111033297, rs111033253, rs104894408, rs111033295, rs397516874, rs76434661, rs111033335, rs397517323, rs111033247, rs367928692, rs374793617, rs143939430, rs397515605, rs80338939, rs200656442, rs779748859, rs587781261, rs587781262, rs143343083, rs200147906, rs730880338, rs797044491, rs146281367, rs756484720, rs869025593, rs201306709, rs540895576, rs777777359, rs879255246, rs1554358720, rs142498437, rs377145777, rs1057517519, rs779077039, rs952741388, rs1060499797, rs764139009, rs1060499590, rs1064794012, rs1064797115, rs756790858, rs775633137, rs1554952443, rs1554952193, rs782063761, rs1199012623, rs756147087, rs1555648043, rs1555661490, rs1553196233, rs781546107, rs111033190, rs775428246, rs782539587, rs537227442, rs148695069, rs1554835827, rs953422571, rs1554834186, rs1554834161, rs1554835103, rs1554577339, rs1554577402, rs768471577, rs782279338, rs781951909, rs998045226, rs375759781, rs755804651, rs1557458426, rs767797828, rs538027448, rs1559366084, rs367688416, rs1558480402, rs1558490542, rs1559870857, rs1560690591, rs1561299289, rs1562817224, rs1562817529, rs1562822565, rs1562835391, rs1564113368, rs1564554255, rs773851192, rs1564555240, rs761261855, rs1564805114, rs1565522273, rs1565127413, rs781790246, rs1565430886, rs1565469959, rs746667217, rs1565819402, rs1565855932, rs150529554, rs1567939793, rs201866631, rs754472294, rs1559372512, rs1558464965, rs1558488902, rs775062249, rs1226171550, rs1561590396, rs765574676, rs762876554, rs757327146, rs1564949059, rs1565519673, rs368050948, rs1565541888, rs781989117, rs1565402473, rs750358148, rs1386887007, rs1209665716, rs1567641234, rs1237955948, rs1569042782, rs752672077, rs146689036, rs1560070780, rs149712664, rs1564556995, rs762226905, rs773573968, rs1568528171, rs1198256157, rs377267777, rs370564476, rs1577876794, rs747787770, rs759432278, rs1043716893, rs1581138934, rs2033773650, rs1421964916, rs771766431, rs780917129, rs1895773215, rs1895769400, rs761543680, rs1565920060 |
|
Hirschsprung disease |
Hirschsprung Disease |
rs104893891, rs76262710, rs75075748, rs75996173, rs79014735, rs77316810, rs75076352, rs76087194, rs76534745, rs76764689, rs76449634, rs78098482, rs79661516, rs104894389, rs769735757, rs267606780, rs1568823467, rs377767412, rs193922699, rs75030001, rs606231342, rs1553540620, rs759944122, rs1057519322, rs1057519323, rs1057519052, rs1588873476, rs1588866040, rs1838178869 |
|
Hydrocephalus |
Hydrocephalus |
rs387907320, rs369384363, rs387907321, rs372127610, rs770273135, rs797045095, rs797045707, rs769795916, rs781251438, rs922703465, rs376078512, rs1567043467, rs1587149916, rs1586841546 |
|
Microcephaly |
Microcephaly |
rs397704721, rs267607176, rs267607177, rs397704725, rs267606717, rs267606718, rs199422202, rs121434311, rs199422203, rs199422126, rs387906274, rs121434305, rs199422125, rs199422135, rs189678019, rs199422184, rs137852994, rs137852995, rs137852996, rs137852997, rs145489194, rs80338860, rs137852494, rs121918609, rs199422207, rs199422206, rs29001566, rs864321658, rs199422138, rs199422139, rs199422141, rs199422144, rs199422147, rs199422151, rs199422152, rs199422153, rs199422157, rs199422159, rs199422160, rs199422161, rs140602858, rs199422164, rs199422165, rs148294838, rs199422134, rs199422168, rs199422172, rs199422173, rs199422131, rs199422177, rs199422180, rs199422185, rs199422186, rs199422187, rs143931757, rs199422189, rs199422192, rs199422194, rs199422195, rs199422196, rs199422197, rs199422199, rs753597039, rs1488084787, rs387906961, rs755862917, rs387907082, rs587776899, rs387907083, rs587776900, rs587776901, rs387907084, rs863223322, rs764201220, rs202247811, rs763915472, rs587776986, rs587777036, rs398122971, rs374351172, rs373278668, rs398122976, rs121909123, rs587783393, rs730882076, rs587783211, rs144716013, rs606231255, rs587783215, rs587783216, rs587783220, rs587783221, rs587783225, rs587783227, rs587783228, rs587783230, rs587783238, rs587783239, rs587783240, rs587783245, rs587783247, rs587783248, rs587783258, rs587783259, rs587783263, rs587783265, rs587783268, rs587783269, rs587783272, rs587783275, rs587783277, rs587783278, rs587783280, rs587783282, rs587783283, rs587783285, rs587783287, rs587783288, rs587783289, rs587783292, rs587783295, rs587784452, rs587783741, rs587783735, rs587783392, rs587783390, rs587783387, rs587783410, rs202058504, rs587783423, rs587783421, rs587783414, rs587784553, rs587784558, rs587784546, rs587784549, rs587784554, rs587784412, rs876661307, rs869025200, rs747831095, rs748529285, rs797045316, rs797045315, rs797045314, rs759632528, rs797045313, rs797045311, rs754282058, rs797045441, rs797045454, rs797045430, rs869312853, rs797046109, rs767399782, rs863225127, rs863225464, rs863225465, rs780270096, rs864321621, rs864321620, rs775277800, rs879253817, rs869312824, rs761447719, rs753406334, rs147622433, rs199422137, rs879255522, rs879255524, rs879255523, rs886037892, rs886037893, rs886037894, rs886037895, rs199422169, rs886041709, rs886041282, rs138228629, rs759188041, rs769688376, rs1057517688, rs1057519087, rs1057518268, rs933106143, rs201362977, rs754909135, rs1057520873, rs1060499758, rs1060499757, rs199422146, rs748016594, rs1085307120, rs763715733, rs1064795945, rs763800571, rs1554728351, rs1553227021, rs555866170, rs1553895368, rs1334947797, rs769818500, rs1321892596, rs1553227645, rs1404276011, rs1553228275, rs1554471681, rs1554496609, rs1555420891, rs1555418825, rs587784548, rs1555723585, rs199736219, rs745997770, rs765275884, rs1553924800, rs1554730137, rs1229568621, rs1482100822, rs979186313, rs758157294, rs1555294652, rs1555299107, rs1553264033, rs1553259539, rs1553254322, rs1553259528, rs981349334, rs1553264036, rs1553253022, rs754267846, rs776034810, rs1342429887, rs752140135, rs1006898944, rs571640983, rs1477524771, rs763909256, rs199910503, rs1553223496, rs759663956, rs1553446603, rs1555139372, rs1555143325, rs1350194762, rs1555141158, rs1553225179, rs769481947, rs769364943, rs748011724, rs1334301723, rs746341112, rs149225624, rs765113367, rs1567024512, rs142865061, rs772050241, rs201721894, rs1557966012, rs1379578836, rs1568334868, rs1185537869, rs1602333390, rs1163303148, rs774338373, rs770540184, rs1571600045, rs1571601267, rs1571602991, rs1588472215, rs1599841026, rs1558328287, rs1571600860, rs1571596976, rs1309880692, rs1435239428, rs1588634016, rs1751797979, rs1810830776, rs1815354949, rs1949984655, rs886039658, rs1943461045, rs777711720, rs2031759596, rs1555710223, rs1221031683, rs774069989, rs2058919680, rs1170413397, rs1213710245, rs1599851667, rs1599760058, rs1971033478, rs746967357 |
|
Multiple congenital anomalies |
Multiple congenital anomalies |
rs1057517732 |
24715698, 24003905, 18000904, 23568615, 22541558, 27642715 |
Nager syndrome |
Nager syndrome |
rs387907185, rs387907186, rs797045125, rs397515324, rs797045121, rs797045122, rs797045123, rs797045124, rs797045126, rs797045127, rs797045128, rs797045129, rs797045130, rs797045131, rs797045132, rs797045133, rs797045134, rs797045954, rs797045957, rs797045955, rs797045956 |
22541558, 24003905 |
Osteochondrodysplasia |
Osteochondrodysplasias |
rs386833498, rs104893919, rs104893916, rs386833492, rs121908078, rs386833497, rs386833507, rs200963884, rs121908077, rs786204675, rs763198695, rs1554095433, rs766836061 |
|
Phocomelia |
Phocomelia |
rs104893835, rs387907231, rs397514643, rs397514666, rs879255548 |
|
Polymicrogyria |
Polymicrogyria |
rs1558010146, rs1558003446, rs1575508937 |
|
Radioulnar synostosis |
Radioulnar Synostosis |
rs1595756416, rs1595756703, rs1231501584, rs1595756962, rs1595757203, rs1595763070, rs1595766210 |
|
Scoliosis |
Scoliosis, unspecified |
rs1057518828, rs147296805, rs758163506, rs1555613564, rs1596852902, rs1596853067, rs1596853085 |
|
Skeletal dysplasia |
Skeletal dysplasia |
rs121912632, rs121912633, rs121912634, rs121912636, rs121912637, rs267607147, rs387906324, rs267607150, rs397514473, rs398123438, rs515726153, rs515726154, rs515726162, rs515726163, rs515726172, rs757011098 |
|
Tetralogy of fallot |
Tetralogy of Fallot |
rs28939668, rs727504412, rs864321649, rs774966208, rs876660981, rs886044220, rs1114167357, rs1569484126, rs1569484164, rs1569484122, rs1569484124, rs1569484042, rs1569484120, rs1569484299, rs1569484301, rs1569484288 |
|
|
Unknown |
Disease name |
Disease term |
dbSNP ID |
References |
Aqueductal stenosis |
Aqueductal Stenosis |
|
|
Arrhinencephaly |
Arhinencephaly |
|
|
Clinodactyly |
Clinodactyly of fingers, Clinodactyly |
|
|
Congenital clubfoot |
Congenital clubfoot |
|
|
Congenital hypoplasia of radius |
Congenital hypoplasia of radius |
|
|
Dwarfism |
Dwarfism |
|
|
Dysmorphic features |
Dysmorphic features |
|
23568615, 22541558, 27642715, 24715698, 24003905, 18000904 |
Gastroschisis |
Gastroschisis |
|
|
Hypoplasia of rib |
Hypoplasia of first ribs |
|
|
Hypoplasia of the epiglottis |
Hypoplasia of the epiglottis |
|
|
Hypoplasia of the maxilla |
Hypoplasia of the maxilla |
|
|
Laryngeal hypoplasia |
Laryngeal hypoplasia |
|
|
Macrostomia |
Macrostomia |
|
|
Micrognathism |
Micrognathism |
|
|
Microtia |
Congenital small ears |
|
24003905 |
Posteriorly rotated ear |
Posteriorly rotated ear |
|
|
Ptosis |
Blepharoptosis, Ptosis |
rs139920573 |
|
Renal aplasia |
Unilateral agenesis of kidney |
|
|
Sprengel deformity |
Sprengel deformity |
|
|
Stenosis of external auditory canal |
Stenosis of external auditory canal |
|
|
Syndactyly of fingers |
Syndactyly of fingers |
|
|
Syndactyly of the toes |
Syndactyly of the toes |
|
|
Thumb aplasia |
Thumb aplasia |
|
|
Trismus |
Trismus |
|
|
Urticaria |
Urticaria |
|
|
Uterine anomalies |
Uterine Anomalies |
|
|
Velopharyngeal insufficiency |
Velopharyngeal Insufficiency |
|
|
|
|
|