Gene
Entrez ID Entrez Gene ID - the GENE ID in NCBI Gene database.
5054
Gene name Gene Name - the full gene name approved by the HGNC.
Serpin family E member 1
Gene symbol Gene Symbol - the official gene symbol approved by the HGNC.
SERPINE1
Synonyms (NCBI Gene) Gene synonyms aliases
PAI, PAI-1, PAI1, PLANH1
Chromosome Chromosome number
7
Chromosome location Chromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
7q22.1
Summary Summary of gene provided in NCBI Entrez Gene.
This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. The protein also functions as
SNPs SNP information provided by dbSNP.
SNP ID Visualize variation Clinical significance Consequence
rs1799762 ->G Pathogenic, other Upstream transcript variant
rs1194865614 ->TA Pathogenic Coding sequence variant, frameshift variant
rs1554362148 ->C Pathogenic Coding sequence variant, frameshift variant
rs1584902091 ACATGAGTTCATCTATTTCCTGCCCACATCTGGTATAAAAGGAGGCAGTGGCCCACAGAGGAGCACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTCCAGCAGCTGAATTCCTGCAGCTCAGCAGCCGCCGCCAGAGCAGGACGAACCGCCAATCGCAAGGCACCTCTGAGAACTTCAGGTAGGAGAAAAGCAAACTCCCTCCAACCTCTTACTTCGGGCTTAAGGCAG Likely-pathogenic 5 prime UTR variant, upstream transcript variant, intron variant, splice donor variant
miRNA miRNA information provided by mirtarbase database.
miRTarBase ID miRNA Experiments Reference
MIRT005844 hsa-miR-204-5p Microarray 21282569
MIRT005971 hsa-miR-30c-5p Luciferase reporter assay 21175428
MIRT005971 hsa-miR-30c-5p Luciferase reporter assay 21175428
MIRT005972 hsa-miR-301a-3p Luciferase reporter assay 21175428
MIRT005972 hsa-miR-301a-3p Luciferase reporter assay 21175428
Transcription factors
Transcription factor Regulation Reference
ARNTL2 Activation 22198637
E2F1 Repression 11402043;11559366
EPAS1 Activation 15039136
ESR1 Activation 15217907
ESR2 Repression 15217907
Gene ontology (GO) Gene ontology information of associated ontologies with gene provided by GO database.
GO ID Ontology Definition Evidence Reference
GO:0001525 Process Angiogenesis IEP 11866539
GO:0002020 Function Protease binding IPI 2503541, 8508955, 8626514, 12114510, 15853774
GO:0004866 Function Endopeptidase inhibitor activity IDA 8626514
GO:0004867 Function Serine-type endopeptidase inhibitor activity IBA
GO:0004867 Function Serine-type endopeptidase inhibitor activity IDA 1695900, 8508955, 21925150
Other IDs Other ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
MIM HGNC e!Ensembl
173360 8583 ENSG00000106366
Protein
UniProt ID P05121
Protein name Plasminogen activator inhibitor 1 (PAI) (PAI-1) (Endothelial plasminogen activator inhibitor) (Serpin E1)
Protein function Serine protease inhibitor. Inhibits TMPRSS7 (PubMed:15853774). Is a primary inhibitor of tissue-type plasminogen activator (PLAT) and urokinase-type plasminogen activator (PLAU). As PLAT inhibitor, it is required for fibrinolysis down-regulation
PDB 1A7C , 1B3K , 1C5G , 1DB2 , 1DVM , 1DVN , 1LJ5 , 1OC0 , 3CVM , 3EOX , 3PB1 , 3Q02 , 3Q03 , 3R4L , 3UT3 , 4AQH , 4G8O , 4G8R , 4IC0 , 5BRR , 5ZLZ , 6GWN , 6GWP , 6GWQ , 6I8S , 6ZRV , 7AQF , 7AQG , 9PAI
Family and domains

Pfam

Accession ID Position in sequence Description Type
PF00079 Serpin 33 402 Serpin (serine protease inhibitor) Domain
Tissue specificity TISSUE SPECIFICITY: Expressed in endothelial cells (PubMed:2430793, PubMed:3097076). Found in plasma, platelets, and hepatoma and fibrosarcoma cells. {ECO:0000269|PubMed:2430793, ECO:0000269|PubMed:3097076}.
Sequence
Sequence length 402
Interactions View interactions
<
Associated diseases Disease associations categorized as Causal (pathogenic variants), Unknown (uncertain genetic evidence), or Text Mining (literature-based associations)
Unknown Includes: (1) ClinVar NON-pathogenic variants (Uncertain, Benign, Conflicting, VUS), (2) GenCC associations, (3) GWAS associations, (4) CBGDA evidence-based associations. NOTE: Diseases with pathogenic evidence are excluded to avoid conflicts.
Disease merge term Disease name Evidence References Source
Congenital Plasminogen Activator Inhibitor Deficiency congenital plasminogen activator inhibitor type 1 deficiency N/A N/A ClinVar
Diabetes Type 2 diabetes N/A N/A GWAS
Associations from Text Mining Disease associations identified through Pubtator
Disease Name Relationship Type References
3 Methylglutaconic Aciduria Type I Stimulate 15158909
Abortion Habitual Associate 24189965, 24484533, 27504943, 30680517
Abortion Spontaneous Associate 24189965, 27504943, 29264983, 34360543, 35955896, 38057822
Acidosis Renal Tubular Associate 37758806
Acute Coronary Syndrome Stimulate 20061546
Acute Coronary Syndrome Associate 25788758, 35109843, 40257950
Acute Kidney Injury Associate 32496420
Acute Lung Injury Associate 19387177
Adenocarcinoma Associate 17264880
Adenocarcinoma of Lung Associate 35710585