PRKCG (protein kinase C gamma)
|
Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
5582 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Protein kinase C gamma |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
PRKCG |
SynonymsGene synonyms aliases
|
PKC-gamma, PKCC, PKCG, PKCI(3), PKCgamma, SCA14 |
ChromosomeChromosome number
|
19 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
19q13.42 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015] |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs78437096 |
T>A,C,G |
Benign, pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
rs121918511 |
C>T |
Pathogenic |
Coding sequence variant, missense variant |
rs121918512 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs121918513 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs121918514 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
rs121918515 |
A>G |
Pathogenic |
Coding sequence variant, missense variant |
rs121918516 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
rs121918517 |
A>C,G |
Pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
rs121918518 |
C>G |
Pathogenic |
Coding sequence variant, missense variant |
rs386134157 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
rs386134158 |
G>C |
Pathogenic |
Missense variant, coding sequence variant |
rs386134159 |
G>T |
Pathogenic |
Missense variant, coding sequence variant |
rs386134160 |
T>A,C |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs386134161 |
ACACAA>- |
Pathogenic |
Coding sequence variant, inframe deletion |
rs386134162 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs386134163 |
C>T |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs386134164 |
G>A,C |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
rs386134165 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs386134166 |
T>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs386134167 |
G>A |
Pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
rs386134168 |
T>A,C |
Pathogenic |
Missense variant, coding sequence variant |
rs386134169 |
C>A |
Pathogenic |
Missense variant, coding sequence variant |
rs386134170 |
GC>TT |
Pathogenic |
Missense variant, coding sequence variant |
rs386134171 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
rs387906679 |
G>T |
Pathogenic |
Coding sequence variant, missense variant |
rs797045900 |
T>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1303074743 |
C>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1406338491 |
G>A,T |
Likely-pathogenic |
Splice donor variant |
rs1555806333 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs1555808841 |
GTAATCTCACCCGCCGCCACTAGGTGTCCCCAACGTCCCCTCCGCCGTGCCGGCGGCAGCCCCACTTCACCCCCAACTTCACCACCCCCTGTCCCATTCTAG>- |
Pathogenic |
Stop lost, terminator codon variant, splice donor variant, inframe indel, intron variant, 3 prime UTR variant, splice acceptor variant |
rs1599938631 |
G>A |
Uncertain-significance, likely-pathogenic |
Coding sequence variant, missense variant |
rs1599943097 |
C>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
P05129 |
Protein name |
Protein kinase C gamma type (PKC-gamma) (EC 2.7.11.13) |
Protein function |
Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that plays diverse roles in neuronal cells and eye tissues, such as regulation of the neuronal receptors GRIA4/GLUR4 and GRIN1/NMDAR1, modulation of receptors and neuronal functions related to sensitivity to opiates, pain and alcohol, mediation of synaptic function and cell survival after ischemia, and inhibition of gap junction activity after oxidative stress. Binds and phosphorylates GRIA4/GLUR4 glutamate receptor and regulates its function by increasing plasma membrane-associated GRIA4 expression. In primary cerebellar neurons treated with the agonist 3,5-dihyidroxyphenylglycine, functions downstream of the metabotropic glutamate receptor GRM5/MGLUR5 and phosphorylates GRIN1/NMDAR1 receptor which plays a key role in synaptic plasticity, synaptogenesis, excitotoxicity, memory acquisition and learning. May be involved in the regulation of hippocampal long-term potentiation (LTP), but may be not necessary for the process of synaptic plasticity. May be involved in desensitization of mu-type opioid receptor-mediated G-protein activation in the spinal cord, and may be critical for the development and/or maintenance of morphine-induced reinforcing effects in the limbic forebrain. May modulate the functionality of mu-type-opioid receptors by participating in a signaling pathway which leads to the phosphorylation and degradation of opioid receptors. May also contributes to chronic morphine-induced changes in nociceptive processing. Plays a role in neuropathic pain mechanisms and contributes to the maintenance of the allodynia pain produced by peripheral inflammation. Plays an important role in initial sensitivity and tolerance to ethanol, by mediating the behavioral effects of ethanol as well as the effects of this drug on the GABA(A) receptors. During and after cerebral ischemia modulate neurotransmission and cell survival in synaptic membranes, and is involved in insulin-induced inhibition of necrosis, an important mechanism for minimizing ischemic injury. Required for the elimination of multiple climbing fibers during innervation of Purkinje cells in developing cerebellum. Is activated in lens epithelial cells upon hydrogen peroxide treatment, and phosphorylates connexin-43 (GJA1/CX43), resulting in disassembly of GJA1 gap junction plaques and inhibition of gap junction activity which could provide a protective effect against oxidative stress (By similarity). Phosphorylates p53/TP53 and promotes p53/TP53-dependent apoptosis in response to DNA damage. Involved in the phase resetting of the cerebral cortex circadian clock during temporally restricted feeding. Stabilizes the core clock component ARNTL/BMAL1 by interfering with its ubiquitination, thus suppressing its degradation, resulting in phase resetting of the cerebral cortex clock (By similarity). |
PDB |
2E73
,
2UZP
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00130 |
C1_1 |
36 → 88 |
Phorbol esters/diacylglycerol binding domain (C1 domain) |
Domain |
PF00130 |
C1_1 |
101 → 153 |
Phorbol esters/diacylglycerol binding domain (C1 domain) |
Domain |
PF00168 |
C2 |
171 → 277 |
C2 domain |
Domain |
PF00069 |
Pkinase |
351 → 613 |
Protein kinase domain |
Domain |
PF00433 |
Pkinase_C |
639 → 675 |
Protein kinase C terminal domain |
Family |
|
Sequence |
|
Sequence length |
697 |
Interactions |
View interactions |
|
|