MET (MET proto-oncogene, receptor tyrosine kinase)
|
| Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
4233 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
MET proto-oncogene, receptor tyrosine kinase |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
MET |
SynonymsGene synonyms aliases
|
AUTS9, DA11, DFNB97, HGFR, RCCP2, c-Met |
ChromosomeChromosome number
|
7 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
7q31.2 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form |
SNPsSNP information provided by dbSNP.
|
| SNP ID |
Visualize variation |
Clinical significance |
Consequence |
| rs34589476 |
C>T |
Likely-pathogenic, conflicting-interpretations-of-pathogenicity, likely-benign |
Non coding transcript variant, missense variant, genic downstream transcript variant, coding sequence variant |
| rs35776110 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign, benign-likely-benign |
Non coding transcript variant, genic upstream transcript variant, missense variant, intron variant, coding sequence variant |
| rs45520237 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Non coding transcript variant, synonymous variant, coding sequence variant |
| rs56311081 |
C>A,T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Non coding transcript variant, stop gained, genic upstream transcript variant, missense variant, intron variant, coding sequence variant |
| rs56391007 |
C>T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity, likely-pathogenic, benign-likely-benign |
Non coding transcript variant, missense variant, genic downstream transcript variant, coding sequence variant |
| rs121913243 |
A>C,G |
Pathogenic, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913244 |
C>T |
Likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913245 |
T>C |
Likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913246 |
A>G |
Pathogenic, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913247 |
T>C |
Uncertain-significance, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913668 |
T>C |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913669 |
G>A,T |
Uncertain-significance, pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913670 |
G>A |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913671 |
G>A,C |
Pathogenic, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913673 |
C>G,T |
Uncertain-significance, pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913675 |
C>T |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913676 |
G>A,C,T |
Pathogenic, likely-pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs121913677 |
A>G |
Pathogenic |
Genic downstream transcript variant, missense variant, coding sequence variant, non coding transcript variant |
| rs180985111 |
G>A |
Not-provided, conflicting-interpretations-of-pathogenicity, likely-benign |
Non coding transcript variant, intron variant, missense variant, coding sequence variant, genic upstream transcript variant |
| rs200074800 |
G>A,T |
Not-provided, conflicting-interpretations-of-pathogenicity, likely-benign |
Intron variant, non coding transcript variant, missense variant, coding sequence variant, genic upstream transcript variant |
| rs200740468 |
G>A,C |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Missense variant, coding sequence variant, non coding transcript variant |
| rs200861145 |
T>A |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Intron variant, non coding transcript variant, missense variant, coding sequence variant, genic upstream transcript variant |
| rs201274041 |
G>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Intron variant, non coding transcript variant, missense variant, coding sequence variant, genic upstream transcript variant |
| rs398123568 |
C>G |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Non coding transcript variant, missense variant, coding sequence variant |
| rs398123569 |
C>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Non coding transcript variant, genic downstream transcript variant, missense variant, coding sequence variant |
| rs398123570 |
G>C |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Non coding transcript variant, genic downstream transcript variant, missense variant, coding sequence variant |
| rs587780736 |
C>-,CC |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Intron variant |
| rs772860611 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Coding sequence variant, genic downstream transcript variant, non coding transcript variant, synonymous variant |
| rs776014448 |
A>G |
Conflicting-interpretations-of-pathogenicity |
Coding sequence variant, genic upstream transcript variant, intron variant, non coding transcript variant, missense variant |
| rs786202724 |
G>A |
Pathogenic, likely-pathogenic |
Coding sequence variant, non coding transcript variant, genic downstream transcript variant, missense variant |
| rs794728016 |
T>G |
Pathogenic |
Coding sequence variant, non coding transcript variant, missense variant |
| rs869320706 |
GAGCTACTTTTCCAGAAGGTATATTTC>- |
Risk-factor |
Intron variant, genic downstream transcript variant, splice donor variant, coding sequence variant, non coding transcript variant |
| rs869320707 |
G>T |
Risk-factor |
Genic downstream transcript variant, splice donor variant |
| rs1057519824 |
T>G |
Likely-pathogenic |
Non coding transcript variant, genic downstream transcript variant, coding sequence variant, missense variant |
| rs1057520030 |
A>G,T |
Likely-pathogenic |
Non coding transcript variant, genic downstream transcript variant, coding sequence variant, missense variant |
| rs1554400286 |
A>G |
Risk-factor |
Genic downstream transcript variant, coding sequence variant, missense variant, non coding transcript variant |
| rs1584941533 |
T>C |
Conflicting-interpretations-of-pathogenicity |
Missense variant, coding sequence variant, non coding transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
| miRTarBase ID |
miRNA |
Experiments |
Reference |
| MIRT001969 |
hsa-miR-199a-3p |
Luciferase reporter assay, Western blot |
18456660 |
| MIRT004292 |
hsa-miR-23b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
19490101 |
| MIRT004292 |
hsa-miR-23b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
19490101 |
| MIRT004292 |
hsa-miR-23b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
19490101 |
| MIRT004292 |
hsa-miR-23b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
19490101 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, Western blot |
18818206 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, Western blot |
18818206 |
| MIRT000759 |
hsa-miR-34a-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000758 |
hsa-miR-34b-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000757 |
hsa-miR-34c-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000757 |
hsa-miR-34c-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000758 |
hsa-miR-34b-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000759 |
hsa-miR-34a-5p |
Review, Luciferase reporter assay |
19461653 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, Western blot, Northern blot |
19029026 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, Western blot, Northern blot |
19029026 |
| MIRT000759 |
hsa-miR-34a-5p |
qRT-PCR, Western blot |
20309880 |
| MIRT000185 |
hsa-miR-206 |
qRT-PCR, ChIP, Luciferase reporter assay, Western blot, Northern blot |
20388878 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay |
18818206 |
| MIRT001969 |
hsa-miR-199a-3p |
Luciferase reporter assay |
18456660 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay |
19029026 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay |
18834857 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
20198305 |
| MIRT004825 |
hsa-miR-34b-3p |
Microarray, Western blot, RTPCR |
20924086 |
| MIRT000757 |
hsa-miR-34c-5p |
Microarray, Western blot, RTPCR |
20924086 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, Western blot |
18593903 |
| MIRT005024 |
hsa-miR-562 |
Luciferase reporter assay |
19789318 |
| MIRT005167 |
hsa-miR-30a-5p |
pSILAC |
18668040 |
| MIRT001357 |
hsa-miR-1-3p |
pSILAC |
18668040 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
19773441 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
19773441 |
| MIRT000759 |
hsa-miR-34a-5p |
qRT-PCR, Western blot |
19006648 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, Western blot |
19710019 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, Western blot |
19710019 |
| MIRT000185 |
hsa-miR-206 |
Luciferase reporter assay, Western blot |
19710019 |
| MIRT000185 |
hsa-miR-206 |
Luciferase reporter assay, Western blot |
19710019 |
| MIRT000185 |
hsa-miR-206 |
Western blot |
19620785 |
| MIRT005458 |
hsa-miR-340-5p |
Immunohistochemistry, Luciferase reporter assay, qRT-PCR, Western blot |
21692045 |
| MIRT001357 |
hsa-miR-1-3p |
qRT-PCR |
21169019 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
22457788 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT006346 |
hsa-miR-449a |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT006351 |
hsa-miR-449b-5p |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
22457788 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT006346 |
hsa-miR-449a |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT006351 |
hsa-miR-449b-5p |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
22457788 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT004825 |
hsa-miR-34b-3p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
22419847 |
| MIRT006346 |
hsa-miR-449a |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT006351 |
hsa-miR-449b-5p |
Luciferase reporter assay, Western blot |
21418558 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay |
22159222 |
| MIRT000759 |
hsa-miR-34a-5p |
Luciferase reporter assay |
22159222 |
| MIRT006778 |
hsa-miR-198 |
Luciferase reporter assay, qRT-PCR, Western blot |
21658389 |
| MIRT006778 |
hsa-miR-198 |
Luciferase reporter assay, qRT-PCR, Western blot |
21658389 |
| MIRT006778 |
hsa-miR-198 |
Luciferase reporter assay, qRT-PCR, Western blot |
21658389 |
| MIRT006778 |
hsa-miR-198 |
Luciferase reporter assay, qRT-PCR, Western blot |
21658389 |
| MIRT007137 |
hsa-miR-130a-3p |
qRT-PCR |
23418453 |
| MIRT016691 |
hsa-miR-133b |
Reporter assay |
20505319 |
| MIRT001539 |
hsa-miR-155-5p |
Other |
18668040 |
| MIRT004292 |
hsa-miR-23b-3p |
Reporter assay;Western blot;qRT-PCR |
19490101 |
| MIRT001357 |
hsa-miR-1-3p |
Proteomics |
18668040 |
| MIRT001357 |
hsa-miR-1-3p |
Microarray |
18668037 |
| MIRT000759 |
hsa-miR-34a-5p |
qRT-PCR |
21240262 |
| MIRT005167 |
hsa-miR-30a-5p |
Proteomics;Other |
18668040 |
| MIRT035528 |
hsa-miR-31-5p |
Luciferase reporter assay |
23552883 |
| MIRT035528 |
hsa-miR-31-5p |
Luciferase reporter assay |
23553486 |
| MIRT044529 |
hsa-miR-320a |
CLASH |
23622248 |
| MIRT035879 |
hsa-miR-1303 |
CLASH |
23622248 |
| MIRT053148 |
hsa-miR-27a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
23650389 |
| MIRT053148 |
hsa-miR-27a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
23650389 |
| MIRT053225 |
hsa-miR-137 |
Luciferase reporter assay, qRT-PCR, Western blot |
23151846 |
| MIRT053225 |
hsa-miR-137 |
Luciferase reporter assay, qRT-PCR, Western blot |
23151846 |
| MIRT035528 |
hsa-miR-31-5p |
Immunoblot, Immunohistochemistry, Luciferase reporter assay, qRT-PCR |
22948084 |
| MIRT054232 |
hsa-miR-410-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
22750473 |
| MIRT054388 |
hsa-miR-148a-3p |
Immunoblot, Immunofluorescence, Immunohistochemistry, Luciferase reporter assay, qRT-PCR, Western blot |
24013226 |
| MIRT054388 |
hsa-miR-148a-3p |
Immunoblot, Immunofluorescence, Immunohistochemistry, Luciferase reporter assay, qRT-PCR, Western blot |
24013226 |
| MIRT006346 |
hsa-miR-449a |
Luciferase reporter assay, Western Blot, qRT-PCR |
23734217 |
| MIRT001969 |
hsa-miR-199a-3p |
Immunofluorescence, Microarray, QRTPCRWestern blot |
24810336 |
| MIRT437442 |
hsa-miR-409-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
23820886 |
| MIRT437442 |
hsa-miR-409-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
23820886 |
| MIRT000759 |
hsa-miR-34a-5p |
5.0 |
24983493 |
| MIRT437858 |
hsa-miR-101-3p |
Luciferase reporter assay, Western blot |
23618864 |
| MIRT437858 |
hsa-miR-101-3p |
Luciferase reporter assay, Western blot |
23618864 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunofluorescence, qRT-PCR, Western blot |
23970470 |
| MIRT438442 |
hsa-miR-7515 |
Luciferase reporter assay, qRT-PCR, Western blot |
23087254 |
| MIRT001357 |
hsa-miR-1-3p |
Microarray, qRT-PCR, Western blot |
25874496 |
| MIRT438343 |
hsa-miR-144-3p |
ChIP-seq, Luciferase reporter assay, Microarray, qRT-PCR, Western blot |
25927670 |
| MIRT438343 |
hsa-miR-144-3p |
ChIP-seq, Luciferase reporter assay, Microarray, qRT-PCR, Western blot |
25927670 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
23922103 |
| MIRT016691 |
hsa-miR-133b |
Western blot |
24391788 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunofluorescence, qRT-PCR, Western blot |
23970470 |
| MIRT438442 |
hsa-miR-7515 |
Luciferase reporter assay, qRT-PCR, Western blot |
23087254 |
| MIRT001357 |
hsa-miR-1-3p |
Microarray, qRT-PCR, Western blot |
25874496 |
| MIRT438343 |
hsa-miR-144-3p |
ChIP-seq, Luciferase reporter assay, Microarray, qRT-PCR, Western blot |
25927670 |
| MIRT438343 |
hsa-miR-144-3p |
ChIP-seq, Luciferase reporter assay, Microarray, qRT-PCR, Western blot |
25927670 |
| MIRT000757 |
hsa-miR-34c-5p |
Luciferase reporter assay |
23922103 |
| MIRT016691 |
hsa-miR-133b |
Western blot |
24391788 |
| MIRT440251 |
hsa-miR-218-5p |
HITS-CLIP |
23212916 |
| MIRT440251 |
hsa-miR-218-5p |
HITS-CLIP |
23212916 |
| MIRT004292 |
hsa-miR-23b-3p |
qRT-PCR, Luciferase reporter assay, Western blot |
25405368 |
| MIRT004292 |
hsa-miR-23b-3p |
qRT-PCR, Luciferase reporter assay, Western blot |
25405368 |
| MIRT004292 |
hsa-miR-23b-3p |
qRT-PCR, Luciferase reporter assay, Western blot |
25405368 |
| MIRT004292 |
hsa-miR-23b-3p |
qRT-PCR, Luciferase reporter assay, Western blot |
25405368 |
| MIRT731338 |
hsa-miR-433-3p |
Luciferase reporter assay |
26844702 |
| MIRT731338 |
hsa-miR-433-3p |
Luciferase reporter assay |
26844702 |
| MIRT001969 |
hsa-miR-199a-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
26051997 |
| MIRT000759 |
hsa-miR-34a-5p |
Flow, Immunofluorescence, In situ hybridization, qRT-PCR, Western blot |
26313360 |
| MIRT319319 |
hsa-miR-449c-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
26141986 |
| MIRT319319 |
hsa-miR-449c-5p |
Luciferase reporter assay, qRT-PCR, Western blot |
26141986 |
| MIRT000185 |
hsa-miR-206 |
FACS, Flow, Immunohistochemistry, qRT-PCR, Western blot |
26186594 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunohistochemistry, qRT-PCR, Western blot |
26238271 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunohistochemistry, qRT-PCR, Western blot |
26238271 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunohistochemistry, qRT-PCR, Western blot |
26238271 |
| MIRT732083 |
hsa-miR-139-5p |
Immunofluorescence, Luciferase reporter assay, qRT-PCR, Western blot |
26497851 |
| MIRT732083 |
hsa-miR-139-5p |
Immunofluorescence, Luciferase reporter assay, qRT-PCR, Western blot |
26497851 |
| MIRT000759 |
hsa-miR-34a-5p |
Flow, Luciferase reporter assay, qRT-PCR, Western blot |
27513895 |
| MIRT000759 |
hsa-miR-34a-5p |
Flow, Luciferase reporter assay, qRT-PCR, Western blot |
27513895 |
| MIRT004292 |
hsa-miR-23b-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
28077801 |
| MIRT000757 |
hsa-miR-34c-5p |
Next Generation Sequencing (NGS), qRT-PCR, Western blot |
26795575 |
| MIRT000757 |
hsa-miR-34c-5p |
Next Generation Sequencing (NGS), qRT-PCR, Western blot |
26795575 |
| MIRT000759 |
hsa-miR-34a-5p |
Immunoblot, qRT-PCR |
28250026 |
| MIRT001969 |
hsa-miR-199a-3p |
RMUG-S" |
25839163 |
| MIRT438343 |
hsa-miR-144-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
26250785 |
| MIRT006346 |
hsa-miR-449a |
Luciferase reporter assay, qRT-PCR, Western blot |
26471185 |
| MIRT001357 |
hsa-miR-1-3p |
Luciferase reporter assay, qRT-PCR, Western blot |
27247259 |
| MIRT732632 |
hsa-miR-203a-3p |
Immunofluorescence, Luciferase reporter assay, qRT-PCR, Western blotting |
34147083 |
| MIRT004825 |
hsa-miR-34b-3p |
Western blotting, Microarray, Immunohistochemistry (IHC), qRT-PCR |
33300049 |
| MIRT755947 |
hsa-miR-128-3p |
Luciferase reporter assay, Western blotting, qRT-PCR |
35252056 |
| MIRT756301 |
hsa-miR-181a-3p |
Luciferase reporter assay |
38030594 |
| MIRT1143383 |
hsa-miR-1 |
CLIP-seq |
|
| MIRT1143384 |
hsa-miR-1207-3p |
CLIP-seq |
|
| MIRT1143385 |
hsa-miR-1264 |
CLIP-seq |
|
| MIRT1143386 |
hsa-miR-1271 |
CLIP-seq |
|
| MIRT1143387 |
hsa-miR-1283 |
CLIP-seq |
|
| MIRT1143388 |
hsa-miR-1284 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT1143390 |
hsa-miR-130a |
CLIP-seq |
|
| MIRT1143391 |
hsa-miR-130b |
CLIP-seq |
|
| MIRT1143392 |
hsa-miR-182 |
CLIP-seq |
|
| MIRT1143393 |
hsa-miR-186 |
CLIP-seq |
|
| MIRT1143394 |
hsa-miR-2054 |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143396 |
hsa-miR-301a |
CLIP-seq |
|
| MIRT1143397 |
hsa-miR-301b |
CLIP-seq |
|
| MIRT1143398 |
hsa-miR-302f |
CLIP-seq |
|
| MIRT1143399 |
hsa-miR-31 |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143401 |
hsa-miR-3130-3p |
CLIP-seq |
|
| MIRT1143402 |
hsa-miR-3143 |
CLIP-seq |
|
| MIRT1143403 |
hsa-miR-3182 |
CLIP-seq |
|
| MIRT1143404 |
hsa-miR-3188 |
CLIP-seq |
|
| MIRT1143405 |
hsa-miR-3192 |
CLIP-seq |
|
| MIRT1143406 |
hsa-miR-335 |
CLIP-seq |
|
| MIRT1143407 |
hsa-miR-337-3p |
CLIP-seq |
|
| MIRT1143408 |
hsa-miR-3613-3p |
CLIP-seq |
|
| MIRT1143409 |
hsa-miR-361-5p |
CLIP-seq |
|
| MIRT1143410 |
hsa-miR-3666 |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143413 |
hsa-miR-3689d |
CLIP-seq |
|
| MIRT1143414 |
hsa-miR-369-3p |
CLIP-seq |
|
| MIRT1143415 |
hsa-miR-371-5p |
CLIP-seq |
|
| MIRT1143416 |
hsa-miR-371b-5p |
CLIP-seq |
|
| MIRT1143417 |
hsa-miR-374a |
CLIP-seq |
|
| MIRT1143418 |
hsa-miR-374b |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143421 |
hsa-miR-3919 |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT1143423 |
hsa-miR-4277 |
CLIP-seq |
|
| MIRT1143424 |
hsa-miR-4282 |
CLIP-seq |
|
| MIRT1143425 |
hsa-miR-4295 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT1143427 |
hsa-miR-4421 |
CLIP-seq |
|
| MIRT1143428 |
hsa-miR-4470 |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT1143431 |
hsa-miR-4490 |
CLIP-seq |
|
| MIRT1143432 |
hsa-miR-454 |
CLIP-seq |
|
| MIRT1143433 |
hsa-miR-4666-3p |
CLIP-seq |
|
| MIRT1143434 |
hsa-miR-4671-3p |
CLIP-seq |
|
| MIRT1143435 |
hsa-miR-4684-5p |
CLIP-seq |
|
| MIRT1143436 |
hsa-miR-4711-3p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT1143438 |
hsa-miR-4756-3p |
CLIP-seq |
|
| MIRT1143439 |
hsa-miR-4774-5p |
CLIP-seq |
|
| MIRT1143440 |
hsa-miR-4793-3p |
CLIP-seq |
|
| MIRT1143441 |
hsa-miR-4796-5p |
CLIP-seq |
|
| MIRT1143442 |
hsa-miR-4797-5p |
CLIP-seq |
|
| MIRT1143443 |
hsa-miR-4803 |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143445 |
hsa-miR-495 |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT1143447 |
hsa-miR-502-5p |
CLIP-seq |
|
| MIRT1143448 |
hsa-miR-581 |
CLIP-seq |
|
| MIRT1143449 |
hsa-miR-592 |
CLIP-seq |
|
| MIRT1143450 |
hsa-miR-593 |
CLIP-seq |
|
| MIRT1143451 |
hsa-miR-599 |
CLIP-seq |
|
| MIRT1143452 |
hsa-miR-613 |
CLIP-seq |
|
| MIRT1143453 |
hsa-miR-633 |
CLIP-seq |
|
| MIRT1143454 |
hsa-miR-661 |
CLIP-seq |
|
| MIRT1143455 |
hsa-miR-759 |
CLIP-seq |
|
| MIRT1143456 |
hsa-miR-96 |
CLIP-seq |
|
| MIRT1143457 |
hsa-miR-128 |
CLIP-seq |
|
| MIRT1143458 |
hsa-miR-1290 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT1143390 |
hsa-miR-130a |
CLIP-seq |
|
| MIRT1143391 |
hsa-miR-130b |
CLIP-seq |
|
| MIRT1143459 |
hsa-miR-148a |
CLIP-seq |
|
| MIRT1143460 |
hsa-miR-148b |
CLIP-seq |
|
| MIRT1143461 |
hsa-miR-152 |
CLIP-seq |
|
| MIRT1143462 |
hsa-miR-2113 |
CLIP-seq |
|
| MIRT1143463 |
hsa-miR-27a |
CLIP-seq |
|
| MIRT1143464 |
hsa-miR-27b |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143396 |
hsa-miR-301a |
CLIP-seq |
|
| MIRT1143397 |
hsa-miR-301b |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143402 |
hsa-miR-3143 |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT1143466 |
hsa-miR-3167 |
CLIP-seq |
|
| MIRT1143404 |
hsa-miR-3188 |
CLIP-seq |
|
| MIRT1143405 |
hsa-miR-3192 |
CLIP-seq |
|
| MIRT1143467 |
hsa-miR-323-3p |
CLIP-seq |
|
| MIRT1143407 |
hsa-miR-337-3p |
CLIP-seq |
|
| MIRT1143409 |
hsa-miR-361-5p |
CLIP-seq |
|
| MIRT1143468 |
hsa-miR-3662 |
CLIP-seq |
|
| MIRT1143410 |
hsa-miR-3666 |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143413 |
hsa-miR-3689d |
CLIP-seq |
|
| MIRT1143414 |
hsa-miR-369-3p |
CLIP-seq |
|
| MIRT1143417 |
hsa-miR-374a |
CLIP-seq |
|
| MIRT1143418 |
hsa-miR-374b |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT1143469 |
hsa-miR-4263 |
CLIP-seq |
|
| MIRT1143424 |
hsa-miR-4282 |
CLIP-seq |
|
| MIRT1143425 |
hsa-miR-4295 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT1143470 |
hsa-miR-4446-3p |
CLIP-seq |
|
| MIRT1143471 |
hsa-miR-4474-3p |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT1143472 |
hsa-miR-4486 |
CLIP-seq |
|
| MIRT1143473 |
hsa-miR-4492 |
CLIP-seq |
|
| MIRT1143474 |
hsa-miR-4498 |
CLIP-seq |
|
| MIRT1143475 |
hsa-miR-4505 |
CLIP-seq |
|
| MIRT1143432 |
hsa-miR-454 |
CLIP-seq |
|
| MIRT1143433 |
hsa-miR-4666-3p |
CLIP-seq |
|
| MIRT1143434 |
hsa-miR-4671-3p |
CLIP-seq |
|
| MIRT1143476 |
hsa-miR-4712-5p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT1143477 |
hsa-miR-4799-5p |
CLIP-seq |
|
| MIRT1143443 |
hsa-miR-4803 |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143478 |
hsa-miR-513a-5p |
CLIP-seq |
|
| MIRT1143479 |
hsa-miR-526b |
CLIP-seq |
|
| MIRT1143480 |
hsa-miR-576-5p |
CLIP-seq |
|
| MIRT1143481 |
hsa-miR-578 |
CLIP-seq |
|
| MIRT1143453 |
hsa-miR-633 |
CLIP-seq |
|
| MIRT1143454 |
hsa-miR-661 |
CLIP-seq |
|
| MIRT1143482 |
hsa-miR-762 |
CLIP-seq |
|
| MIRT1143483 |
hsa-miR-770-5p |
CLIP-seq |
|
| MIRT1143484 |
hsa-miR-876-5p |
CLIP-seq |
|
| MIRT2040796 |
hsa-miR-1205 |
CLIP-seq |
|
| MIRT2040797 |
hsa-miR-1206 |
CLIP-seq |
|
| MIRT2040798 |
hsa-miR-1228 |
CLIP-seq |
|
| MIRT2040799 |
hsa-miR-1267 |
CLIP-seq |
|
| MIRT1143387 |
hsa-miR-1283 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT2040800 |
hsa-miR-181a |
CLIP-seq |
|
| MIRT2040801 |
hsa-miR-181b |
CLIP-seq |
|
| MIRT2040802 |
hsa-miR-181c |
CLIP-seq |
|
| MIRT2040803 |
hsa-miR-181d |
CLIP-seq |
|
| MIRT2040804 |
hsa-miR-2052 |
CLIP-seq |
|
| MIRT1143462 |
hsa-miR-2113 |
CLIP-seq |
|
| MIRT2040805 |
hsa-miR-2114 |
CLIP-seq |
|
| MIRT2040806 |
hsa-miR-2117 |
CLIP-seq |
|
| MIRT2040807 |
hsa-miR-23a |
CLIP-seq |
|
| MIRT2040808 |
hsa-miR-23b |
CLIP-seq |
|
| MIRT2040809 |
hsa-miR-23c |
CLIP-seq |
|
| MIRT2040810 |
hsa-miR-24 |
CLIP-seq |
|
| MIRT2040811 |
hsa-miR-2682 |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143398 |
hsa-miR-302f |
CLIP-seq |
|
| MIRT2040812 |
hsa-miR-3121-3p |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143402 |
hsa-miR-3143 |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT1143403 |
hsa-miR-3182 |
CLIP-seq |
|
| MIRT1143404 |
hsa-miR-3188 |
CLIP-seq |
|
| MIRT1143405 |
hsa-miR-3192 |
CLIP-seq |
|
| MIRT1143467 |
hsa-miR-323-3p |
CLIP-seq |
|
| MIRT2040813 |
hsa-miR-329 |
CLIP-seq |
|
| MIRT2040814 |
hsa-miR-340 |
CLIP-seq |
|
| MIRT2040815 |
hsa-miR-34a |
CLIP-seq |
|
| MIRT2040816 |
hsa-miR-3529 |
CLIP-seq |
|
| MIRT1143408 |
hsa-miR-3613-3p |
CLIP-seq |
|
| MIRT1143409 |
hsa-miR-361-5p |
CLIP-seq |
|
| MIRT2040817 |
hsa-miR-362-3p |
CLIP-seq |
|
| MIRT1143468 |
hsa-miR-3662 |
CLIP-seq |
|
| MIRT2040818 |
hsa-miR-3674 |
CLIP-seq |
|
| MIRT2040819 |
hsa-miR-3679-3p |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143413 |
hsa-miR-3689d |
CLIP-seq |
|
| MIRT2040820 |
hsa-miR-3692 |
CLIP-seq |
|
| MIRT1143415 |
hsa-miR-371-5p |
CLIP-seq |
|
| MIRT1143416 |
hsa-miR-371b-5p |
CLIP-seq |
|
| MIRT2040821 |
hsa-miR-379 |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT2040822 |
hsa-miR-383 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT2040823 |
hsa-miR-425 |
CLIP-seq |
|
| MIRT2040824 |
hsa-miR-4255 |
CLIP-seq |
|
| MIRT2040825 |
hsa-miR-4262 |
CLIP-seq |
|
| MIRT2040826 |
hsa-miR-4273 |
CLIP-seq |
|
| MIRT1143423 |
hsa-miR-4277 |
CLIP-seq |
|
| MIRT1143424 |
hsa-miR-4282 |
CLIP-seq |
|
| MIRT2040827 |
hsa-miR-4284 |
CLIP-seq |
|
| MIRT2040828 |
hsa-miR-4307 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT2040829 |
hsa-miR-4451 |
CLIP-seq |
|
| MIRT2040830 |
hsa-miR-4453 |
CLIP-seq |
|
| MIRT1143471 |
hsa-miR-4474-3p |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT1143431 |
hsa-miR-4490 |
CLIP-seq |
|
| MIRT2040831 |
hsa-miR-449b |
CLIP-seq |
|
| MIRT2040832 |
hsa-miR-449c |
CLIP-seq |
|
| MIRT2040833 |
hsa-miR-4504 |
CLIP-seq |
|
| MIRT2040834 |
hsa-miR-4521 |
CLIP-seq |
|
| MIRT2040835 |
hsa-miR-4538 |
CLIP-seq |
|
| MIRT2040836 |
hsa-miR-4540 |
CLIP-seq |
|
| MIRT2040837 |
hsa-miR-4650-3p |
CLIP-seq |
|
| MIRT1143433 |
hsa-miR-4666-3p |
CLIP-seq |
|
| MIRT2040838 |
hsa-miR-4666-5p |
CLIP-seq |
|
| MIRT1143435 |
hsa-miR-4684-5p |
CLIP-seq |
|
| MIRT2040839 |
hsa-miR-4687-5p |
CLIP-seq |
|
| MIRT1143436 |
hsa-miR-4711-3p |
CLIP-seq |
|
| MIRT2040840 |
hsa-miR-4711-5p |
CLIP-seq |
|
| MIRT2040841 |
hsa-miR-4725-5p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT2040842 |
hsa-miR-4729 |
CLIP-seq |
|
| MIRT2040843 |
hsa-miR-4731-5p |
CLIP-seq |
|
| MIRT1143439 |
hsa-miR-4774-5p |
CLIP-seq |
|
| MIRT2040844 |
hsa-miR-4793-5p |
CLIP-seq |
|
| MIRT1143443 |
hsa-miR-4803 |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143445 |
hsa-miR-495 |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT1143447 |
hsa-miR-502-5p |
CLIP-seq |
|
| MIRT2040845 |
hsa-miR-504 |
CLIP-seq |
|
| MIRT2040846 |
hsa-miR-513c |
CLIP-seq |
|
| MIRT2040847 |
hsa-miR-514b-5p |
CLIP-seq |
|
| MIRT2040848 |
hsa-miR-548aa |
CLIP-seq |
|
| MIRT2040849 |
hsa-miR-550b |
CLIP-seq |
|
| MIRT2040850 |
hsa-miR-579 |
CLIP-seq |
|
| MIRT1143448 |
hsa-miR-581 |
CLIP-seq |
|
| MIRT1143449 |
hsa-miR-592 |
CLIP-seq |
|
| MIRT2040851 |
hsa-miR-595 |
CLIP-seq |
|
| MIRT1143451 |
hsa-miR-599 |
CLIP-seq |
|
| MIRT2040852 |
hsa-miR-610 |
CLIP-seq |
|
| MIRT2040853 |
hsa-miR-629 |
CLIP-seq |
|
| MIRT2040854 |
hsa-miR-642b |
CLIP-seq |
|
| MIRT1143454 |
hsa-miR-661 |
CLIP-seq |
|
| MIRT2040855 |
hsa-miR-664 |
CLIP-seq |
|
| MIRT1143455 |
hsa-miR-759 |
CLIP-seq |
|
| MIRT2040796 |
hsa-miR-1205 |
CLIP-seq |
|
| MIRT2040797 |
hsa-miR-1206 |
CLIP-seq |
|
| MIRT1143384 |
hsa-miR-1207-3p |
CLIP-seq |
|
| MIRT2040798 |
hsa-miR-1228 |
CLIP-seq |
|
| MIRT2270485 |
hsa-miR-1269 |
CLIP-seq |
|
| MIRT2270486 |
hsa-miR-1269b |
CLIP-seq |
|
| MIRT1143386 |
hsa-miR-1271 |
CLIP-seq |
|
| MIRT1143388 |
hsa-miR-1284 |
CLIP-seq |
|
| MIRT1143458 |
hsa-miR-1290 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT2270487 |
hsa-miR-1297 |
CLIP-seq |
|
| MIRT2270488 |
hsa-miR-1305 |
CLIP-seq |
|
| MIRT1143390 |
hsa-miR-130a |
CLIP-seq |
|
| MIRT1143391 |
hsa-miR-130b |
CLIP-seq |
|
| MIRT1143392 |
hsa-miR-182 |
CLIP-seq |
|
| MIRT1143393 |
hsa-miR-186 |
CLIP-seq |
|
| MIRT2270489 |
hsa-miR-1912 |
CLIP-seq |
|
| MIRT2040805 |
hsa-miR-2114 |
CLIP-seq |
|
| MIRT2040806 |
hsa-miR-2117 |
CLIP-seq |
|
| MIRT2040807 |
hsa-miR-23a |
CLIP-seq |
|
| MIRT2040808 |
hsa-miR-23b |
CLIP-seq |
|
| MIRT2040809 |
hsa-miR-23c |
CLIP-seq |
|
| MIRT2040810 |
hsa-miR-24 |
CLIP-seq |
|
| MIRT2040811 |
hsa-miR-2682 |
CLIP-seq |
|
| MIRT2270490 |
hsa-miR-26a |
CLIP-seq |
|
| MIRT2270491 |
hsa-miR-26b |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143396 |
hsa-miR-301a |
CLIP-seq |
|
| MIRT1143397 |
hsa-miR-301b |
CLIP-seq |
|
| MIRT1143399 |
hsa-miR-31 |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143402 |
hsa-miR-3143 |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT1143466 |
hsa-miR-3167 |
CLIP-seq |
|
| MIRT1143467 |
hsa-miR-323-3p |
CLIP-seq |
|
| MIRT1143406 |
hsa-miR-335 |
CLIP-seq |
|
| MIRT1143407 |
hsa-miR-337-3p |
CLIP-seq |
|
| MIRT2040814 |
hsa-miR-340 |
CLIP-seq |
|
| MIRT2040815 |
hsa-miR-34a |
CLIP-seq |
|
| MIRT1143409 |
hsa-miR-361-5p |
CLIP-seq |
|
| MIRT2270492 |
hsa-miR-3665 |
CLIP-seq |
|
| MIRT1143410 |
hsa-miR-3666 |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143414 |
hsa-miR-369-3p |
CLIP-seq |
|
| MIRT1143417 |
hsa-miR-374a |
CLIP-seq |
|
| MIRT1143418 |
hsa-miR-374b |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT2040822 |
hsa-miR-383 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT2040824 |
hsa-miR-4255 |
CLIP-seq |
|
| MIRT2040826 |
hsa-miR-4273 |
CLIP-seq |
|
| MIRT1143423 |
hsa-miR-4277 |
CLIP-seq |
|
| MIRT2040827 |
hsa-miR-4284 |
CLIP-seq |
|
| MIRT1143425 |
hsa-miR-4295 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT2270493 |
hsa-miR-4465 |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT2040831 |
hsa-miR-449b |
CLIP-seq |
|
| MIRT2040832 |
hsa-miR-449c |
CLIP-seq |
|
| MIRT2270494 |
hsa-miR-4520b-3p |
CLIP-seq |
|
| MIRT2270495 |
hsa-miR-4529-3p |
CLIP-seq |
|
| MIRT1143432 |
hsa-miR-454 |
CLIP-seq |
|
| MIRT1143434 |
hsa-miR-4671-3p |
CLIP-seq |
|
| MIRT2040839 |
hsa-miR-4687-5p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT2040842 |
hsa-miR-4729 |
CLIP-seq |
|
| MIRT1143440 |
hsa-miR-4793-3p |
CLIP-seq |
|
| MIRT2040844 |
hsa-miR-4793-5p |
CLIP-seq |
|
| MIRT1143443 |
hsa-miR-4803 |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT2040846 |
hsa-miR-513c |
CLIP-seq |
|
| MIRT2040847 |
hsa-miR-514b-5p |
CLIP-seq |
|
| MIRT2040848 |
hsa-miR-548aa |
CLIP-seq |
|
| MIRT2040850 |
hsa-miR-579 |
CLIP-seq |
|
| MIRT2270496 |
hsa-miR-591 |
CLIP-seq |
|
| MIRT1143453 |
hsa-miR-633 |
CLIP-seq |
|
| MIRT2270497 |
hsa-miR-657 |
CLIP-seq |
|
| MIRT1143484 |
hsa-miR-876-5p |
CLIP-seq |
|
| MIRT2270498 |
hsa-miR-940 |
CLIP-seq |
|
| MIRT1143456 |
hsa-miR-96 |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT1143433 |
hsa-miR-4666-3p |
CLIP-seq |
|
| MIRT2040846 |
hsa-miR-513c |
CLIP-seq |
|
| MIRT2040847 |
hsa-miR-514b-5p |
CLIP-seq |
|
| MIRT2040854 |
hsa-miR-642b |
CLIP-seq |
|
| MIRT1143387 |
hsa-miR-1283 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT1143408 |
hsa-miR-3613-3p |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143415 |
hsa-miR-371-5p |
CLIP-seq |
|
| MIRT1143416 |
hsa-miR-371b-5p |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT1143427 |
hsa-miR-4421 |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT1143435 |
hsa-miR-4684-5p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143445 |
hsa-miR-495 |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT1143383 |
hsa-miR-1 |
CLIP-seq |
|
| MIRT2569626 |
hsa-miR-101 |
CLIP-seq |
|
| MIRT2569627 |
hsa-miR-1266 |
CLIP-seq |
|
| MIRT1143457 |
hsa-miR-128 |
CLIP-seq |
|
| MIRT1143387 |
hsa-miR-1283 |
CLIP-seq |
|
| MIRT1143388 |
hsa-miR-1284 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT2270487 |
hsa-miR-1297 |
CLIP-seq |
|
| MIRT2569628 |
hsa-miR-144 |
CLIP-seq |
|
| MIRT1143459 |
hsa-miR-148a |
CLIP-seq |
|
| MIRT1143460 |
hsa-miR-148b |
CLIP-seq |
|
| MIRT1143461 |
hsa-miR-152 |
CLIP-seq |
|
| MIRT1143392 |
hsa-miR-182 |
CLIP-seq |
|
| MIRT2040804 |
hsa-miR-2052 |
CLIP-seq |
|
| MIRT1143462 |
hsa-miR-2113 |
CLIP-seq |
|
| MIRT2270490 |
hsa-miR-26a |
CLIP-seq |
|
| MIRT2270491 |
hsa-miR-26b |
CLIP-seq |
|
| MIRT1143463 |
hsa-miR-27a |
CLIP-seq |
|
| MIRT1143464 |
hsa-miR-27b |
CLIP-seq |
|
| MIRT1143395 |
hsa-miR-300 |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT2569629 |
hsa-miR-3124-3p |
CLIP-seq |
|
| MIRT2569630 |
hsa-miR-3136-5p |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT2569631 |
hsa-miR-3171 |
CLIP-seq |
|
| MIRT2040813 |
hsa-miR-329 |
CLIP-seq |
|
| MIRT2569632 |
hsa-miR-342-5p |
CLIP-seq |
|
| MIRT1143408 |
hsa-miR-3613-3p |
CLIP-seq |
|
| MIRT2040817 |
hsa-miR-362-3p |
CLIP-seq |
|
| MIRT2569633 |
hsa-miR-3646 |
CLIP-seq |
|
| MIRT1143468 |
hsa-miR-3662 |
CLIP-seq |
|
| MIRT2040818 |
hsa-miR-3674 |
CLIP-seq |
|
| MIRT2569634 |
hsa-miR-3677-5p |
CLIP-seq |
|
| MIRT2569635 |
hsa-miR-3682-3p |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT2040820 |
hsa-miR-3692 |
CLIP-seq |
|
| MIRT1143415 |
hsa-miR-371-5p |
CLIP-seq |
|
| MIRT1143416 |
hsa-miR-371b-5p |
CLIP-seq |
|
| MIRT2569636 |
hsa-miR-380 |
CLIP-seq |
|
| MIRT1143419 |
hsa-miR-381 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT1143469 |
hsa-miR-4263 |
CLIP-seq |
|
| MIRT1143423 |
hsa-miR-4277 |
CLIP-seq |
|
| MIRT1143424 |
hsa-miR-4282 |
CLIP-seq |
|
| MIRT2569637 |
hsa-miR-4283 |
CLIP-seq |
|
| MIRT2569638 |
hsa-miR-4314 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT1143427 |
hsa-miR-4421 |
CLIP-seq |
|
| MIRT2569639 |
hsa-miR-4439 |
CLIP-seq |
|
| MIRT2040830 |
hsa-miR-4453 |
CLIP-seq |
|
| MIRT2270493 |
hsa-miR-4465 |
CLIP-seq |
|
| MIRT1143428 |
hsa-miR-4470 |
CLIP-seq |
|
| MIRT1143471 |
hsa-miR-4474-3p |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT2569640 |
hsa-miR-4481 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT2569641 |
hsa-miR-4489 |
CLIP-seq |
|
| MIRT2569642 |
hsa-miR-4502 |
CLIP-seq |
|
| MIRT2569643 |
hsa-miR-4518 |
CLIP-seq |
|
| MIRT2569644 |
hsa-miR-451b |
CLIP-seq |
|
| MIRT2040835 |
hsa-miR-4538 |
CLIP-seq |
|
| MIRT2569645 |
hsa-miR-4651 |
CLIP-seq |
|
| MIRT2569646 |
hsa-miR-4664-5p |
CLIP-seq |
|
| MIRT1143433 |
hsa-miR-4666-3p |
CLIP-seq |
|
| MIRT2569647 |
hsa-miR-4667-5p |
CLIP-seq |
|
| MIRT1143435 |
hsa-miR-4684-5p |
CLIP-seq |
|
| MIRT2569648 |
hsa-miR-4700-5p |
CLIP-seq |
|
| MIRT2569649 |
hsa-miR-4704-5p |
CLIP-seq |
|
| MIRT2569650 |
hsa-miR-4719 |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT2040843 |
hsa-miR-4731-5p |
CLIP-seq |
|
| MIRT2569651 |
hsa-miR-4738-3p |
CLIP-seq |
|
| MIRT2569652 |
hsa-miR-4742-3p |
CLIP-seq |
|
| MIRT2569653 |
hsa-miR-4745-5p |
CLIP-seq |
|
| MIRT2569654 |
hsa-miR-4758-5p |
CLIP-seq |
|
| MIRT2569655 |
hsa-miR-4774-3p |
CLIP-seq |
|
| MIRT1143441 |
hsa-miR-4796-5p |
CLIP-seq |
|
| MIRT1143442 |
hsa-miR-4797-5p |
CLIP-seq |
|
| MIRT1143477 |
hsa-miR-4799-5p |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT2569656 |
hsa-miR-494 |
CLIP-seq |
|
| MIRT1143445 |
hsa-miR-495 |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT1143478 |
hsa-miR-513a-5p |
CLIP-seq |
|
| MIRT2569657 |
hsa-miR-548t |
CLIP-seq |
|
| MIRT1143480 |
hsa-miR-576-5p |
CLIP-seq |
|
| MIRT2270496 |
hsa-miR-591 |
CLIP-seq |
|
| MIRT2569658 |
hsa-miR-608 |
CLIP-seq |
|
| MIRT1143452 |
hsa-miR-613 |
CLIP-seq |
|
| MIRT2569659 |
hsa-miR-637 |
CLIP-seq |
|
| MIRT2040854 |
hsa-miR-642b |
CLIP-seq |
|
| MIRT2569660 |
hsa-miR-663b |
CLIP-seq |
|
| MIRT1143455 |
hsa-miR-759 |
CLIP-seq |
|
| MIRT2569661 |
hsa-miR-767-3p |
CLIP-seq |
|
| MIRT2569662 |
hsa-miR-943 |
CLIP-seq |
|
| MIRT2569663 |
hsa-miR-3650 |
CLIP-seq |
|
| MIRT2040820 |
hsa-miR-3692 |
CLIP-seq |
|
| MIRT2569664 |
hsa-miR-933 |
CLIP-seq |
|
| MIRT1143387 |
hsa-miR-1283 |
CLIP-seq |
|
| MIRT1143389 |
hsa-miR-1293 |
CLIP-seq |
|
| MIRT2270487 |
hsa-miR-1297 |
CLIP-seq |
|
| MIRT1143392 |
hsa-miR-182 |
CLIP-seq |
|
| MIRT2270490 |
hsa-miR-26a |
CLIP-seq |
|
| MIRT2270491 |
hsa-miR-26b |
CLIP-seq |
|
| MIRT1143400 |
hsa-miR-3122 |
CLIP-seq |
|
| MIRT1143465 |
hsa-miR-3165 |
CLIP-seq |
|
| MIRT2569631 |
hsa-miR-3171 |
CLIP-seq |
|
| MIRT2040813 |
hsa-miR-329 |
CLIP-seq |
|
| MIRT1143408 |
hsa-miR-3613-3p |
CLIP-seq |
|
| MIRT2040817 |
hsa-miR-362-3p |
CLIP-seq |
|
| MIRT2040818 |
hsa-miR-3674 |
CLIP-seq |
|
| MIRT2569635 |
hsa-miR-3682-3p |
CLIP-seq |
|
| MIRT1143411 |
hsa-miR-3689a-3p |
CLIP-seq |
|
| MIRT1143412 |
hsa-miR-3689c |
CLIP-seq |
|
| MIRT1143415 |
hsa-miR-371-5p |
CLIP-seq |
|
| MIRT1143416 |
hsa-miR-371b-5p |
CLIP-seq |
|
| MIRT2569636 |
hsa-miR-380 |
CLIP-seq |
|
| MIRT1143420 |
hsa-miR-3913-5p |
CLIP-seq |
|
| MIRT1143422 |
hsa-miR-3929 |
CLIP-seq |
|
| MIRT1143426 |
hsa-miR-4419b |
CLIP-seq |
|
| MIRT1143427 |
hsa-miR-4421 |
CLIP-seq |
|
| MIRT2040830 |
hsa-miR-4453 |
CLIP-seq |
|
| MIRT2270493 |
hsa-miR-4465 |
CLIP-seq |
|
| MIRT1143428 |
hsa-miR-4470 |
CLIP-seq |
|
| MIRT1143429 |
hsa-miR-4478 |
CLIP-seq |
|
| MIRT1143430 |
hsa-miR-4483 |
CLIP-seq |
|
| MIRT2569642 |
hsa-miR-4502 |
CLIP-seq |
|
| MIRT2040835 |
hsa-miR-4538 |
CLIP-seq |
|
| MIRT1143435 |
hsa-miR-4684-5p |
CLIP-seq |
|
| MIRT1143437 |
hsa-miR-4728-5p |
CLIP-seq |
|
| MIRT2040843 |
hsa-miR-4731-5p |
CLIP-seq |
|
| MIRT1143442 |
hsa-miR-4797-5p |
CLIP-seq |
|
| MIRT1143444 |
hsa-miR-485-5p |
CLIP-seq |
|
| MIRT1143445 |
hsa-miR-495 |
CLIP-seq |
|
| MIRT1143446 |
hsa-miR-500a |
CLIP-seq |
|
| MIRT2040854 |
hsa-miR-642b |
CLIP-seq |
|
| MIRT1143455 |
hsa-miR-759 |
CLIP-seq |
|
|
| Transcription factors
|
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
| GO ID |
Ontology |
Definition |
Evidence |
Reference |
| GO:0000165 |
Process |
MAPK cascade |
TAS |
|
| GO:0001886 |
Process |
Endothelial cell morphogenesis |
IDA |
14500721 |
| GO:0001889 |
Process |
Liver development |
IBA |
21873635 |
| GO:0004713 |
Function |
Protein tyrosine kinase activity |
NAS |
3325883 |
| GO:0004713 |
Function |
Protein tyrosine kinase activity |
TAS |
|
| GO:0004714 |
Function |
Transmembrane receptor protein tyrosine kinase activity |
IBA |
21873635 |
| GO:0005008 |
Function |
Hepatocyte growth factor-activated receptor activity |
IBA |
21873635 |
| GO:0005515 |
Function |
Protein binding |
IPI |
1846706, 11571281, 11590178, 12475979, 15167892, 15184888, 16101282, 16537444, 16537482, 17662939, 17804794, 17981115, 18273061, 18579758, 19167335, 20624308, 20624990, 20802513, 21163258, 21242965, 22404908, 22789536, 22897854, 22962849, 23866081, 24034250, 24189400, 24728074, 2524 |
| GO:0005524 |
Function |
ATP binding |
IEA |
|
| GO:0005576 |
Component |
Extracellular region |
IEA |
|
| GO:0005886 |
Component |
Plasma membrane |
TAS |
|
| GO:0005887 |
Component |
Integral component of plasma membrane |
IBA |
21873635 |
| GO:0006909 |
Process |
Phagocytosis |
IBA |
21873635 |
| GO:0007165 |
Process |
Signal transduction |
TAS |
1846706 |
| GO:0007166 |
Process |
Cell surface receptor signaling pathway |
NAS |
2819873 |
| GO:0007169 |
Process |
Transmembrane receptor protein tyrosine kinase signaling pathway |
IBA |
21873635 |
| GO:0007275 |
Process |
Multicellular organism development |
IBA |
21873635 |
| GO:0007399 |
Process |
Nervous system development |
IBA |
21873635 |
| GO:0009925 |
Component |
Basal plasma membrane |
IBA |
21873635 |
| GO:0009925 |
Component |
Basal plasma membrane |
IDA |
15314156 |
| GO:0009986 |
Component |
Cell surface |
HDA |
19581412 |
| GO:0010507 |
Process |
Negative regulation of autophagy |
NAS |
24743740 |
| GO:0016021 |
Component |
Integral component of membrane |
NAS |
2819873 |
| GO:0016477 |
Process |
Cell migration |
IBA |
21873635 |
| GO:0017154 |
Function |
Semaphorin receptor activity |
IEA |
|
| GO:0018108 |
Process |
Peptidyl-tyrosine phosphorylation |
IEA |
|
| GO:0019903 |
Function |
Protein phosphatase binding |
IPI |
18819921 |
| GO:0030182 |
Process |
Neuron differentiation |
IBA |
21873635 |
| GO:0031016 |
Process |
Pancreas development |
IBA |
21873635 |
| GO:0031116 |
Process |
Positive regulation of microtubule polymerization |
IMP |
25198505 |
| GO:0033674 |
Process |
Positive regulation of kinase activity |
IBA |
21873635 |
| GO:0035024 |
Process |
Negative regulation of Rho protein signal transduction |
IDA |
25198505 |
| GO:0035635 |
Process |
Entry of bacterium into host cell |
TAS |
|
| GO:0042802 |
Function |
Identical protein binding |
IPI |
16537482, 20624990 |
| GO:0043235 |
Component |
Receptor complex |
IBA |
21873635 |
| GO:0045944 |
Process |
Positive regulation of transcription by RNA polymerase II |
IDA |
22521434 |
| GO:0048012 |
Process |
Hepatocyte growth factor receptor signaling pathway |
IEA |
|
| GO:0048754 |
Process |
Branching morphogenesis of an epithelial tube |
IMP |
16153003 |
| GO:0050918 |
Process |
Positive chemotaxis |
IDA |
15218527 |
| GO:0051497 |
Process |
Negative regulation of stress fiber assembly |
IDA |
25198505 |
| GO:0051897 |
Process |
Positive regulation of protein kinase B signaling |
IBA |
21873635 |
| GO:0051897 |
Process |
Positive regulation of protein kinase B signaling |
TAS |
|
| GO:0061436 |
Process |
Establishment of skin barrier |
IMP |
25198505 |
| GO:0070495 |
Process |
Negative regulation of thrombin-activated receptor signaling pathway |
IDA |
25198505 |
| GO:0071526 |
Process |
Semaphorin-plexin signaling pathway |
IDA |
15218527 |
| GO:1901299 |
Process |
Negative regulation of hydrogen peroxide-mediated programmed cell death |
IMP |
20655899 |
| GO:1905098 |
Process |
Negative regulation of guanyl-nucleotide exchange factor activity |
IDA |
25198505 |
| GO:2001028 |
Process |
Positive regulation of endothelial cell chemotaxis |
IMP |
19850054 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
| Protein
|
| UniProt ID |
P08581 |
| Protein name |
Hepatocyte growth factor receptor (HGF receptor) (EC 2.7.10.1) (HGF/SF receptor) (Proto-oncogene c-Met) (Scatter factor receptor) (SF receptor) (Tyrosine-protein kinase Met) |
| Protein function |
Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to hepatocyte growth factor/HGF ligand. Regulates many physiological processes including proliferation, scattering, morphogenesis and su |
| PDB |
1FYR
,
1R0P
,
1R1W
,
1SHY
,
1SSL
,
2G15
,
2RFN
,
2RFS
,
2UZX
,
2UZY
,
2WD1
,
2WGJ
,
2WKM
,
3A4P
,
3BUX
,
3C1X
,
3CCN
,
3CD8
,
3CE3
,
3CTH
,
3CTJ
,
3DKC
,
3DKF
,
3DKG
,
3EFJ
,
3EFK
,
3F66
,
3F82
,
3I5N
,
3L8V
,
3LQ8
,
3Q6U
,
3Q6W
,
3QTI
,
3R7O
,
3RHK
,
3U6H
,
3U6I
,
3VW8
,
3ZBX
,
3ZC5
,
3ZCL
,
3ZXZ
,
3ZZE
,
4AOI
,
4AP7
,
4DEG
,
4DEH
,
4DEI
,
4EEV
,
4GG5
|
| Family and domains |
Pfam
| Accession |
ID |
Position in sequence |
Description |
Type |
| PF01403 |
Sema |
54 → 493 |
Sema domain |
Family |
| PF01437 |
PSI |
519 → 562 |
Plexin repeat |
Family |
| PF01833 |
TIG |
563 → 654 |
IPT/TIG domain |
Domain |
| PF01833 |
TIG |
657 → 738 |
IPT/TIG domain |
Domain |
| PF01833 |
TIG |
742 → 832 |
IPT/TIG domain |
Domain |
| PF07714 |
PK_Tyr_Ser-Thr |
1078 → 1337 |
Protein tyrosine and serine/threonine kinase |
Domain |
|
Sequence |
|
| Sequence length |
1390 |
| Interactions |
View interactions |
|
|
