KCNQ1 (potassium voltage-gated channel subfamily Q member 1)
|
| Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
3784 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Potassium voltage-gated channel subfamily Q member 1 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
KCNQ1 |
SynonymsGene synonyms aliases
|
ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, KVLQT1, Kv1.9, Kv7.1, LQT, LQT1, RWS, SQT2, WRS |
ChromosomeChromosome number
|
11 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
11p15.5-p15.4 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011] |
SNPsSNP information provided by dbSNP.
|
| SNP ID |
Visualize variation |
Clinical significance |
Consequence |
| rs179489 |
G>A,C |
Not-provided, pathogenic |
Missense variant, coding sequence variant |
| rs1800171 |
G>A,C,T |
Likely-pathogenic, pathogenic |
Synonymous variant, coding sequence variant |
| rs12720457 |
G>T |
Benign, likely-benign, benign-likely-benign, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
| rs12720458 |
A>G |
Pathogenic, pathogenic-likely-pathogenic, likely-pathogenic |
Coding sequence variant, missense variant |
| rs12720459 |
C>A,G,T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs17215500 |
C>G,T |
Pathogenic, uncertain-significance, not-provided, likely-pathogenic |
Coding sequence variant, missense variant, stop gained |
| rs17221854 |
C>T |
Risk-factor, pathogenic, not-provided, likely-pathogenic |
Coding sequence variant, missense variant |
| rs74462309 |
A>C,G,T |
Pathogenic, not-provided, likely-pathogenic |
Coding sequence variant, missense variant |
| rs76735093 |
G>A,T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Intron variant |
| rs76737438 |
G>C |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs104894252 |
G>A,C |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
| rs104894255 |
G>A,C,T |
Pathogenic, not-provided |
Missense variant, coding sequence variant |
| rs120074177 |
G>A,C |
Likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074178 |
G>A,C,T |
Likely-pathogenic, uncertain-significance, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074179 |
G>A,C,T |
Likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074180 |
C>G,T |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074181 |
G>A,C |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074182 |
C>T |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074183 |
G>A |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074184 |
G>A,C,T |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074185 |
C>A,T |
Likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074186 |
G>A,C,T |
Likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, stop gained, missense variant |
| rs120074187 |
G>A |
Likely-pathogenic, uncertain-significance |
Coding sequence variant, missense variant |
| rs120074188 |
G>A |
Likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074189 |
C>T |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074190 |
G>A |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074191 |
C>T |
Not-provided, pathogenic |
Coding sequence variant, genic upstream transcript variant, missense variant |
| rs120074192 |
A>G |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074193 |
G>A,C |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074194 |
G>A,T |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074195 |
G>A,C |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs120074196 |
G>A,C |
Not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs138362632 |
G>A,C |
Conflicting-interpretations-of-pathogenicity, uncertain-significance |
Coding sequence variant, missense variant |
| rs138551008 |
C>A,T |
Likely-benign, pathogenic |
Coding sequence variant, stop gained, synonymous variant |
| rs139042529 |
C>A,G,T |
Likely-benign, benign, pathogenic |
Coding sequence variant, stop gained, synonymous variant |
| rs140452381 |
C>T |
Conflicting-interpretations-of-pathogenicity, uncertain-significance, not-provided |
Coding sequence variant, missense variant |
| rs145229963 |
G>A,T |
Uncertain-significance, pathogenic |
Coding sequence variant, missense variant |
| rs149089817 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
| rs151344631 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
| rs181106858 |
C>A,T |
Likely-benign, conflicting-interpretations-of-pathogenicity |
Synonymous variant, coding sequence variant |
| rs193922365 |
C>A,T |
Uncertain-significance, pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472677 |
G>A |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs199472678 |
A>G |
Pathogenic, not-provided |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs199472681 |
G>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs199472685 |
T>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472687 |
G>A |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472696 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472697 |
G>A,C,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472698 |
G>A,C |
Uncertain-significance, pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472700 |
A>G |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472702 |
G>A,C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472705 |
T>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472706 |
C>T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472708 |
G>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472709 |
G>A,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472710 |
T>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472712 |
G>A,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472713 |
C>A,T |
Uncertain-significance, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs199472716 |
T>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472718 |
A>C,G |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472719 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472720 |
G>A,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472722 |
G>A,C,T |
Pathogenic, likely-pathogenic, not-provided |
Stop gained, coding sequence variant, missense variant |
| rs199472724 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472726 |
G>A,T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472728 |
A>G |
Uncertain-significance, likely-pathogenic, not-provided, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
| rs199472730 |
C>G,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472734 |
G>A |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472737 |
C>T |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472745 |
G>A |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472751 |
G>A,T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472752 |
G>A,C |
Pathogenic, not-provided |
Coding sequence variant, missense variant, synonymous variant |
| rs199472753 |
C>G,T |
Uncertain-significance, pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472754 |
A>G |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472755 |
C>A,G,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472756 |
G>A,C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472758 |
C>T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472759 |
T>A,C |
Uncertain-significance, not-provided, pathogenic, pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
| rs199472760 |
C>T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472763 |
C>A,G,T |
Uncertain-significance, likely-pathogenic, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs199472765 |
C>A,G |
Pathogenic, not-provided |
Stop gained, coding sequence variant, missense variant |
| rs199472767 |
T>A |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472768 |
T>C,G |
Likely-pathogenic, not-provided, conflicting-interpretations-of-pathogenicity |
Coding sequence variant, missense variant |
| rs199472771 |
G>A,T |
Not-provided, likely-pathogenic, likely-benign |
Coding sequence variant, missense variant, synonymous variant |
| rs199472775 |
A>T |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472776 |
C>G,T |
Uncertain-significance, likely-pathogenic, not-provided, benign |
Coding sequence variant, missense variant |
| rs199472789 |
A>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472790 |
T>G |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472793 |
C>T |
Uncertain-significance, pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472794 |
G>A,C |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472795 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472800 |
G>A,T |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472801 |
A>G |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472804 |
C>A,T |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472805 |
T>C,G |
Not-provided, pathogenic-likely-pathogenic, pathogenic |
Coding sequence variant, missense variant |
| rs199472806 |
G>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472807 |
G>A,C |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472813 |
G>A,C |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472814 |
G>A,T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472815 |
G>A,C |
Uncertain-significance, pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199472823 |
T>C |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473394 |
G>A |
Uncertain-significance, pathogenic, likely-benign |
Coding sequence variant, missense variant |
| rs199473397 |
A>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473398 |
G>A,C,T |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473399 |
T>C |
Uncertain-significance, not-provided, pathogenic |
Coding sequence variant, missense variant |
| rs199473403 |
T>C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473406 |
A>G,T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473408 |
C>A |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473410 |
G>A,C |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473411 |
C>A,T |
Pathogenic, likely-pathogenic |
Coding sequence variant, missense variant, synonymous variant |
| rs199473441 |
A>G,T |
Pathogenic, not-provided |
Missense variant, genic upstream transcript variant, initiator codon variant |
| rs199473442 |
C>G,T |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs199473443 |
C>T |
Uncertain-significance, not-provided, pathogenic |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs199473450 |
C>T |
Pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473451 |
A>G |
Uncertain-significance, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473455 |
C>G,T |
Likely-pathogenic, not-provided, likely-benign |
Coding sequence variant, missense variant, synonymous variant |
| rs199473456 |
C>T |
Pathogenic, likely-pathogenic |
Coding sequence variant, missense variant |
| rs199473457 |
C>A,T |
Pathogenic, not-provided, pathogenic-likely-pathogenic |
Coding sequence variant, missense variant |
| rs199473459 |
T>C |
Uncertain-significance, pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473460 |
T>C,G |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473471 |
G>A,C |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473479 |
T>G |
Pathogenic, likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473480 |
C>A,T |
Pathogenic, likely-pathogenic, not-provided |
Stop gained, coding sequence variant, missense variant |
| rs199473485 |
T>A,C |
Pathogenic, not-provided |
Missense variant, genic upstream transcript variant, initiator codon variant |
| rs199473661 |
T>C,G |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant |
| rs199473662 |
C>A,T |
Likely-pathogenic, not-provided |
Coding sequence variant, missense variant, synonymous variant |
| rs200612600 |
G>A,T |
Conflicting-interpretations-of-pathogenicity |
Intron variant |
| rs267607197 |
G>A |
Pathogenic |
Coding sequence variant, missense variant |
| rs368507376 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs374090960 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs387906290 |
G>A,C |
Pathogenic |
Splice acceptor variant |
| rs397508067 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508068 |
CTT>- |
Pathogenic |
Coding sequence variant, inframe deletion |
| rs397508069 |
TTT>- |
Pathogenic, not-provided |
Coding sequence variant, inframe deletion |
| rs397508070 |
G>A |
Likely-pathogenic |
Splice donor variant |
| rs397508072 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs397508075 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs397508077 |
TTCA>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508082 |
C>-,CC |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508083 |
A>-,AA |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs397508087 |
C>-,CC |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508096 |
C>G |
Pathogenic |
Stop gained, coding sequence variant, genic upstream transcript variant |
| rs397508097 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs397508107 |
GCCGCGCCC>-,GCCGCGCCCGCCGCGCCC |
Uncertain-significance, pathogenic, not-provided |
Inframe insertion, coding sequence variant, genic upstream transcript variant, inframe deletion |
| rs397508109 |
->T |
Pathogenic |
Coding sequence variant, genic upstream transcript variant, frameshift variant |
| rs397508110 |
CT>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508111 |
G>A,C |
Pathogenic, likely-pathogenic |
Intron variant |
| rs397508112 |
T>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs397508114 |
G>- |
Pathogenic, not-provided |
Coding sequence variant, frameshift variant |
| rs397508115 |
C>GG |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508116 |
T>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508117 |
GG>-,GGG |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508118 |
GCGCT>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508120 |
G>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs397508122 |
G>A |
Pathogenic |
Intron variant |
| rs397508125 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508126 |
TCT>- |
Pathogenic |
Coding sequence variant, inframe deletion |
| rs397508127 |
CTC>- |
Pathogenic |
Coding sequence variant, inframe deletion |
| rs397508129 |
GTGAACGAGTCAGGCCGCG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397508130 |
G>T |
Pathogenic |
Splice donor variant |
| rs397508131 |
G>A |
Likely-pathogenic |
Synonymous variant, coding sequence variant |
| rs397508133 |
A>C,G |
Likely-pathogenic, not-provided |
Splice acceptor variant |
| rs397508134 |
CT>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397515637 |
CAGTAC>GTTGAGA |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs397515877 |
ATCGCGCCC>-,ATCGCGCCCATCGCGCCC,ATCGCGCCCATCGCGCCCATCGCGCCC |
Benign-likely-benign, likely-benign, uncertain-significance, pathogenic |
Inframe insertion, coding sequence variant, genic upstream transcript variant, inframe deletion |
| rs530612385 |
G>A,C |
Pathogenic |
Missense variant, coding sequence variant, stop gained |
| rs752457145 |
C>T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Synonymous variant, coding sequence variant |
| rs762814879 |
G>A |
Pathogenic |
Splice donor variant |
| rs763462603 |
TCTGGTCCGCC>-,TCTGGTCCGCCTCTGGTCCGCC |
Pathogenic, pathogenic-likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs764781840 |
T>C,G |
Likely-pathogenic, uncertain-significance |
Missense variant, coding sequence variant |
| rs765169367 |
G>- |
Pathogenic |
Coding sequence variant, stop gained |
| rs775479779 |
C>A,T |
Likely-pathogenic, likely-benign |
Coding sequence variant, stop gained, synonymous variant |
| rs779383393 |
T>C,G |
Pathogenic |
Missense variant, coding sequence variant |
| rs786204778 |
T>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
| rs794728510 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728511 |
A>C |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728512 |
T>C,G |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728513 |
C>G,T |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728514 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728517 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs794728519 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728520 |
A>G,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728523 |
A>C,G |
Pathogenic |
Splice acceptor variant |
| rs794728524 |
G>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728526 |
A>G,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728527 |
T>A,C |
Likely-benign, likely-pathogenic |
Stop gained, coding sequence variant, synonymous variant |
| rs794728528 |
T>C |
Likely-pathogenic |
Splice donor variant |
| rs794728530 |
G>T |
Pathogenic, likely-pathogenic |
Stop gained, coding sequence variant |
| rs794728531 |
G>A |
Pathogenic, likely-pathogenic |
Splice donor variant |
| rs794728532 |
G>T |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728533 |
G>A |
Pathogenic |
Missense variant, coding sequence variant |
| rs794728534 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728535 |
G>T |
Pathogenic |
Missense variant, coding sequence variant |
| rs794728536 |
A>T |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728537 |
C>T |
Pathogenic, likely-pathogenic |
Stop gained, coding sequence variant |
| rs794728538 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
| rs794728544 |
A>T |
Pathogenic |
Stop gained, coding sequence variant, genic upstream transcript variant |
| rs794728547 |
->A |
Pathogenic |
Stop gained, coding sequence variant |
| rs794728553 |
G>A |
Pathogenic |
Missense variant, coding sequence variant, genic upstream transcript variant |
| rs794728555 |
TTC>- |
Likely-pathogenic |
Inframe deletion, coding sequence variant |
| rs794728556 |
GGCTGCGCTTTGCC>- |
Pathogenic |
Frameshift variant, coding sequence variant |
| rs794728557 |
GTGGTAAGTCGG>- |
Pathogenic-likely-pathogenic |
Splice donor variant, coding sequence variant, intron variant |
| rs794728559 |
->AGC |
Uncertain-significance, likely-pathogenic |
Inframe insertion, coding sequence variant |
| rs794728562 |
G>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, splice acceptor variant |
| rs794728563 |
GCCCGGCGCCCCAGGTCCCGCGC>- |
Pathogenic |
Frameshift variant, coding sequence variant, genic upstream transcript variant |
| rs794728565 |
G>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant |
| rs794728566 |
T>- |
Pathogenic, likely-pathogenic |
Frameshift variant, coding sequence variant |
| rs794728567 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
| rs794728568 |
G>A,T |
Pathogenic, likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728569 |
A>G |
Pathogenic |
Missense variant, coding sequence variant |
| rs794728571 |
C>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs794728572 |
G>A |
Pathogenic-likely-pathogenic |
Stop gained, coding sequence variant |
| rs794728573 |
A>G |
Pathogenic |
Splice acceptor variant |
| rs794728576 |
T>C |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs794728578 |
T>A,G |
Likely-pathogenic |
Missense variant, coding sequence variant, genic upstream transcript variant |
| rs794728579 |
A>T |
Uncertain-significance, likely-pathogenic |
Missense variant, coding sequence variant, genic upstream transcript variant |
| rs794728580 |
CGGTGAGTCAT>- |
Likely-pathogenic |
Splice donor variant, coding sequence variant, intron variant |
| rs796052166 |
T>G |
Likely-pathogenic |
Splice donor variant |
| rs876661350 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
| rs878854347 |
A>- |
Pathogenic |
Frameshift variant, coding sequence variant |
| rs878854348 |
G>C |
Pathogenic |
Splice acceptor variant |
| rs878854350 |
A>G |
Pathogenic, likely-pathogenic |
Splice acceptor variant |
| rs886037906 |
C>T |
Likely-pathogenic |
Missense variant, coding sequence variant, genic upstream transcript variant |
| rs914460959 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs959449103 |
G>A |
Uncertain-significance, likely-pathogenic |
Genic upstream transcript variant, missense variant, coding sequence variant |
| rs1057519584 |
T>A |
Pathogenic |
Missense variant, coding sequence variant |
| rs1057520623 |
C>A |
Pathogenic |
Stop gained, coding sequence variant |
| rs1060500621 |
GA>TT |
Pathogenic |
Missense variant, coding sequence variant |
| rs1060500623 |
C>- |
Pathogenic |
Genic upstream transcript variant, coding sequence variant, frameshift variant |
| rs1060500626 |
AGGCTCCTGG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1060500628 |
G>T |
Pathogenic |
Stop gained, coding sequence variant |
| rs1060500629 |
G>A |
Pathogenic |
Stop gained, coding sequence variant |
| rs1064794538 |
G>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs1064795333 |
CT>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs1064796353 |
GAG>- |
Likely-pathogenic |
Inframe deletion, coding sequence variant |
| rs1085307965 |
A>C |
Likely-pathogenic |
Missense variant, coding sequence variant |
| rs1131691513 |
A>G |
Likely-pathogenic |
Genic upstream transcript variant, coding sequence variant, missense variant |
| rs1135401944 |
A>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1222477763 |
C>A,T |
Pathogenic |
Genic upstream transcript variant, stop gained, synonymous variant, coding sequence variant |
| rs1325525794 |
G>A,C |
Pathogenic, uncertain-significance |
Coding sequence variant, genic upstream transcript variant, missense variant |
| rs1435990592 |
CGGCCGCGCCC>- |
Pathogenic |
Frameshift variant, genic upstream transcript variant, coding sequence variant |
| rs1554892895 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1554892900 |
T>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1554892994 |
->G |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1554893091 |
C>T |
Pathogenic |
Coding sequence variant, stop gained |
| rs1554893092 |
GG>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1554893228 |
C>G |
Pathogenic |
Coding sequence variant, stop gained |
| rs1554893260 |
A>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1554894445 |
A>T |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1554894448 |
T>C |
Pathogenic |
Coding sequence variant, missense variant |
| rs1554894481 |
G>A |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1554895166 |
G>- |
Pathogenic, likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs1554919471 |
G>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1554920580 |
->ATGTG |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1554920808 |
A>G |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1554920833 |
G>- |
Pathogenic |
Intron variant |
| rs1554958030 |
C>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant, genic upstream transcript variant |
| rs1554958043 |
A>T |
Pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant |
| rs1554958045 |
G>T |
Pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant |
| rs1554958047 |
G>T |
Likely-pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant |
| rs1554958049 |
->GGCGGCG |
Pathogenic |
Coding sequence variant, frameshift variant, genic upstream transcript variant |
| rs1554958092 |
G>T |
Likely-pathogenic |
Coding sequence variant, missense variant, genic upstream transcript variant |
| rs1554958132 |
->GC |
Pathogenic |
Coding sequence variant, frameshift variant, genic upstream transcript variant |
| rs1564820372 |
G>C |
Likely-pathogenic |
Splice acceptor variant |
| rs1564820729 |
A>C |
Likely-pathogenic |
Splice acceptor variant |
| rs1564820786 |
ACCTGGAGGC>- |
Pathogenic |
Coding sequence variant, frameshift variant |
| rs1564821090 |
T>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1564825414 |
C>G,T |
Uncertain-significance, pathogenic |
Coding sequence variant, missense variant, stop gained |
| rs1564886323 |
AG>- |
Likely-pathogenic |
Splice acceptor variant |
| rs1564886349 |
A>- |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs1565023136 |
C>- |
Pathogenic |
Coding sequence variant, frameshift variant, genic upstream transcript variant |
| rs1589884185 |
G>A |
Pathogenic |
Coding sequence variant, stop gained, genic upstream transcript variant |
| rs1589931156 |
T>C |
Likely-pathogenic |
Coding sequence variant, missense variant |
| rs1589956565 |
C>- |
Pathogenic |
Coding sequence variant, stop gained |
| rs1589957233 |
G>A |
Likely-pathogenic |
Splice donor variant |
| rs1589957697 |
->GC |
Likely-pathogenic |
Coding sequence variant, frameshift variant |
| rs1589957719 |
C>- |
Pathogenic |
Coding sequence variant, stop gained |
| rs1589968661 |
G>A |
Pathogenic |
Splice donor variant |
| rs1590081328 |
G>A |
Likely-pathogenic |
Splice acceptor variant |
| rs1590081467 |
T>C,G |
Likely-pathogenic, pathogenic |
Splice donor variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
| miRTarBase ID |
miRNA |
Experiments |
Reference |
| MIRT002925 |
hsa-miR-133a-3p |
Luciferase reporter assay, Western blot, 5\'RACE, Real time RT-PCR |
17443681 |
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
| GO ID |
Ontology |
Definition |
Evidence |
Reference |
| GO:0005249 |
Function |
Voltage-gated potassium channel activity |
IBA |
21873635 |
| GO:0005249 |
Function |
Voltage-gated potassium channel activity |
IDA |
8900283, 17289006, 24855057 |
| GO:0005249 |
Function |
Voltage-gated potassium channel activity |
IDA |
16002409 |
| GO:0005251 |
Function |
Delayed rectifier potassium channel activity |
IBA |
21873635 |
| GO:0005251 |
Function |
Delayed rectifier potassium channel activity |
IDA |
12522251, 24184248, 24269949, 25037568 |
| GO:0005251 |
Function |
Delayed rectifier potassium channel activity |
IDA |
8900283, 9354802, 10400998, 11299204, 19646991 |
| GO:0005515 |
Function |
Protein binding |
IPI |
19521339, 19687231, 20533308, 22024150, 23529131 |
| GO:0005516 |
Function |
Calmodulin binding |
IBA |
21873635 |
| GO:0005516 |
Function |
Calmodulin binding |
IDA |
18165683 |
| GO:0005546 |
Function |
Phosphatidylinositol-4,5-bisphosphate binding |
IDA |
25037568 |
| GO:0005737 |
Component |
Cytoplasm |
IDA |
25037568 |
| GO:0005764 |
Component |
Lysosome |
IDA |
21957902 |
| GO:0005769 |
Component |
Early endosome |
IDA |
21957902 |
| GO:0005769 |
Component |
Early endosome |
IMP |
23529131 |
| GO:0005770 |
Component |
Late endosome |
IDA |
21957902 |
| GO:0005783 |
Component |
Endoplasmic reticulum |
IDA |
21228319, 24855057 |
| GO:0005783 |
Component |
Endoplasmic reticulum |
IPI |
24855057 |
| GO:0005886 |
Component |
Plasma membrane |
IDA |
10646604, 21228319, 22024150, 23529131, 24184248, 25037568, 25705178 |
| GO:0005886 |
Component |
Plasma membrane |
TAS |
|
| GO:0006349 |
Process |
Regulation of gene expression by genetic imprinting |
IEA |
|
| GO:0007605 |
Process |
Sensory perception of sound |
TAS |
9020846 |
| GO:0008016 |
Process |
Regulation of heart contraction |
IC |
8900283 |
| GO:0008076 |
Component |
Voltage-gated potassium channel complex |
IBA |
21873635 |
| GO:0008076 |
Component |
Voltage-gated potassium channel complex |
IC |
8900283 |
| GO:0008076 |
Component |
Voltage-gated potassium channel complex |
IDA |
16002409, 17289006, 19646991 |
| GO:0008157 |
Function |
Protein phosphatase 1 binding |
IDA |
11799244 |
| GO:0010460 |
Process |
Positive regulation of heart rate |
IMP |
19646991 |
| GO:0015271 |
Function |
Outward rectifier potassium channel activity |
IBA |
21873635 |
| GO:0015271 |
Function |
Outward rectifier potassium channel activity |
IDA |
9312006, 11101505, 25705178 |
| GO:0016021 |
Component |
Integral component of membrane |
IBA |
21873635 |
| GO:0016323 |
Component |
Basolateral plasma membrane |
IDA |
21228319, 21957902 |
| GO:0016458 |
Process |
Gene silencing |
IEA |
|
| GO:0030659 |
Component |
Cytoplasmic vesicle membrane |
IEA |
|
| GO:0034236 |
Function |
Protein kinase A catalytic subunit binding |
IDA |
11799244 |
| GO:0034237 |
Function |
Protein kinase A regulatory subunit binding |
IDA |
11799244 |
| GO:0034702 |
Component |
Ion channel complex |
IPI |
24855057 |
| GO:0035690 |
Process |
Cellular response to drug |
IDA |
9108097 |
| GO:0044325 |
Function |
Ion channel binding |
IPI |
11101505, 12324418, 20196769, 24855057, 25037568 |
| GO:0045121 |
Component |
Membrane raft |
IDA |
20533308, 24855057 |
| GO:0048839 |
Process |
Inner ear development |
ISS |
|
| GO:0050892 |
Process |
Intestinal absorption |
ISS |
|
| GO:0060048 |
Process |
Cardiac muscle contraction |
IMP |
8528244 |
| GO:0060306 |
Process |
Regulation of membrane repolarization |
IDA |
11299204 |
| GO:0060306 |
Process |
Regulation of membrane repolarization |
IMP |
8900283 |
| GO:0060307 |
Process |
Regulation of ventricular cardiac muscle cell membrane repolarization |
IMP |
8528244 |
| GO:0060372 |
Process |
Regulation of atrial cardiac muscle cell membrane repolarization |
IMP |
12522251 |
| GO:0060452 |
Process |
Positive regulation of cardiac muscle contraction |
IMP |
19646991 |
| GO:0060453 |
Process |
Regulation of gastric acid secretion |
ISS |
|
| GO:0061337 |
Process |
Cardiac conduction |
TAS |
|
| GO:0070293 |
Process |
Renal absorption |
ISS |
|
| GO:0071320 |
Process |
Cellular response to cAMP |
IDA |
11299204, 16002409 |
| GO:0071320 |
Process |
Cellular response to cAMP |
IMP |
18093912 |
| GO:0071805 |
Process |
Potassium ion transmembrane transport |
IBA |
21873635 |
| GO:0071805 |
Process |
Potassium ion transmembrane transport |
IDA |
9354802, 11299204, 16002409 |
| GO:0071872 |
Process |
Cellular response to epinephrine stimulus |
TAS |
11799244 |
| GO:0072359 |
Process |
Circulatory system development |
IEA |
|
| GO:0086005 |
Process |
Ventricular cardiac muscle cell action potential |
IMP |
8528244 |
| GO:0086008 |
Function |
Voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization |
IMP |
12522251 |
| GO:0086011 |
Process |
Membrane repolarization during action potential |
IDA |
8900283, 11299204, 19646991 |
| GO:0086013 |
Process |
Membrane repolarization during cardiac muscle cell action potential |
IMP |
8528244 |
| GO:0086013 |
Process |
Membrane repolarization during cardiac muscle cell action potential |
TAS |
11299204 |
| GO:0086014 |
Process |
Atrial cardiac muscle cell action potential |
IMP |
12522251 |
| GO:0086089 |
Function |
Voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization |
IBA |
21873635 |
| GO:0086089 |
Function |
Voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization |
IMP |
12522251, 25786344 |
| GO:0086091 |
Process |
Regulation of heart rate by cardiac conduction |
IMP |
8528244 |
| GO:0097110 |
Function |
Scaffold protein binding |
IPI |
11799244, 16002409, 18093912 |
| GO:0097623 |
Process |
Potassium ion export across plasma membrane |
IBA |
21873635 |
| GO:0097623 |
Process |
Potassium ion export across plasma membrane |
IDA |
8900283, 10400998, 17289006 |
| GO:0098914 |
Process |
Membrane repolarization during atrial cardiac muscle cell action potential |
IMP |
12522251, 25786344 |
| GO:0098915 |
Process |
Membrane repolarization during ventricular cardiac muscle cell action potential |
IBA |
21873635 |
| GO:0098915 |
Process |
Membrane repolarization during ventricular cardiac muscle cell action potential |
IMP |
8528244 |
| GO:1901381 |
Process |
Positive regulation of potassium ion transmembrane transport |
IDA |
8900283 |
| GO:1902282 |
Function |
Voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization |
IBA |
21873635 |
| GO:1902282 |
Function |
Voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization |
IMP |
8528244 |
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
| Protein
|
| UniProt ID |
P51787 |
| Protein name |
Potassium voltage-gated channel subfamily KQT member 1 (IKs producing slow voltage-gated potassium channel subunit alpha KvLQT1) (KQT-like 1) (Voltage-gated potassium channel subunit Kv7.1) |
| Protein function |
Potassium channel that plays an important role in a number of tissues, including heart, inner ear, stomach and colon (PubMed:10646604, PubMed:25441029). Associates with KCNE beta subunits that modulates current kinetics (PubMed:9312006, PubMed:9108097, PubMed:8900283, PubMed:10646604, PubMed:11101505, PubMed:19687231). Induces a voltage-dependent current by rapidly activating and slowly deactivating potassium-selective outward current (PubMed:9312006, PubMed:9108097, PubMed:8900283, PubMed:10646604, PubMed:11101505, PubMed:25441029). Promotes also a delayed voltage activated potassium current showing outward rectification characteristic (By similarity). During beta-adrenergic receptor stimulation participates in cardiac repolarization by associating with KCNE1 to form the I(Ks) cardiac potassium current that increases the amplitude and slows down the activation kinetics of outward potassium current I(Ks) (By similarity) (PubMed:9312006, PubMed:9108097, PubMed:8900283, PubMed:10646604, PubMed:11101505). Muscarinic agonist oxotremorine-M strongly suppresses KCNQ1/KCNE1 current (PubMed:10713961). When associated with KCNE3, forms the potassium channel that is important for cyclic AMP-stimulated intestinal secretion of chloride ions (PubMed:10646604). This interaction with KCNE3 is reduced by 17beta-estradiol, resulting in the reduction of currents (By similarity). During conditions of increased substrate load, maintains the driving force for proximal tubular and intestinal sodium ions absorption, gastric acid secretion, and cAMP-induced jejunal chloride ions secretion (By similarity). Allows the provision of potassium ions to the luminal membrane of the secretory canaliculus in the resting state as well as during stimulated acid secretion (By similarity). When associated with KCNE2, forms a heterooligomer complex leading to currents with an apparently instantaneous activation, a rapid deactivation process and a linear current-voltage relationship and decreases the amplitude of the outward current (PubMed:11101505). When associated with KCNE4, inhibits voltage-gated potassium channel activity (PubMed:19687231). When associated with KCNE5, this complex only conducts current upon strong and continued depolarization (PubMed:12324418). Also forms a heterotetramer with KCNQ5; has a voltage-gated potassium channel activity (PubMed:24855057). Binds with phosphatidylinositol 4,5-bisphosphate (PubMed:25037568). ; [Isoform 2]: Non-functional alone but modulatory when coexpressed with the full-length isoform 1. |
| PDB |
3BJ4
,
3HFC
,
3HFE
,
4UMO
,
4V0C
,
6MIE
,
6UZZ
,
6V00
,
6V01
|
| Family and domains |
Pfam
| Accession |
ID |
Position in sequence |
Description |
Type |
| PF00520 |
Ion_trans |
122 → 359 |
Ion transport protein |
Family |
| PF03520 |
KCNQ_channel |
482 → 620 |
KCNQ voltage-gated potassium channel |
Family |
|
Sequence |
|
| Sequence length |
676 |
| Interactions |
View interactions |
|
|
