Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
111 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
Adenylate cyclase 5 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ADCY5 |
SynonymsGene synonyms aliases
|
AC5, DSKOD, FDFM |
ChromosomeChromosome number
|
3 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
3q21.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha sub |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs61734561 |
C>G,T |
Conflicting-interpretations-of-pathogenicity, likely-benign |
Coding sequence variant, synonymous variant, missense variant |
rs548282891 |
C>T |
Uncertain-significance, conflicting-interpretations-of-pathogenicity |
Missense variant, genic upstream transcript variant, coding sequence variant |
rs746547282 |
C>T |
Likely-pathogenic |
Splice donor variant |
rs757156390 |
G>A,C |
Pathogenic |
Missense variant, synonymous variant, coding sequence variant |
rs765349480 |
C>G,T |
Likely-pathogenic |
Coding sequence variant, missense variant |
rs796065306 |
C>T |
Pathogenic |
Missense variant, coding sequence variant |
rs797045002 |
C>A,T |
Pathogenic |
Splice donor variant |
rs864309483 |
G>A |
Conflicting-interpretations-of-pathogenicity, pathogenic |
Missense variant, coding sequence variant, 5 prime UTR variant |
rs864309484 |
A>T |
Pathogenic |
Missense variant, coding sequence variant |
rs864309515 |
C>T |
Pathogenic |
Missense variant, coding sequence variant, 5 prime UTR variant |
rs910314734 |
G>C,T |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1057520218 |
G>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1085308027 |
C>A |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1215504032 |
AGCCGCCGCCGCCG>- |
Pathogenic |
Coding sequence variant, genic upstream transcript variant, frameshift variant |
rs1553718964 |
G>T |
Pathogenic |
Missense variant, stop gained, coding sequence variant |
rs1553726054 |
T>A,C |
Likely-pathogenic |
Missense variant, stop gained, coding sequence variant |
rs1553732126 |
->G |
Likely-pathogenic |
Frameshift variant, 5 prime UTR variant, coding sequence variant |
rs1553751151 |
G>T |
Pathogenic |
Stop gained, genic upstream transcript variant, coding sequence variant |
rs1553751262 |
GCCGAGCCGCCGCCGCCGCC>-,GCC |
Likely-pathogenic |
Frameshift variant, genic upstream transcript variant, coding sequence variant |
rs1576526285 |
T>G |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1576606182 |
T>A,C |
Likely-pathogenic |
Missense variant, coding sequence variant |
rs1576606282 |
G>A |
Likely-pathogenic |
5 prime UTR variant, coding sequence variant, missense variant |
rs1576704514 |
AG>- |
Likely-pathogenic |
Frameshift variant, coding sequence variant, genic upstream transcript variant |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
O95622 |
Protein name |
Adenylate cyclase type 5 (EC 4.6.1.1) (ATP pyrophosphate-lyase 5) (Adenylate cyclase type V) (Adenylyl cyclase 5) (AC5) |
Protein function |
Catalyzes the formation of the signaling molecule cAMP in response to G-protein signaling (PubMed:15385642, PubMed:24700542, PubMed:26206488). Mediates signaling downstream of ADRB1 (PubMed:24700542). Regulates the increase of free cytosolic Ca( |
PDB |
8SL3
,
8SL4
|
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF16214 |
AC_N |
1 → 458 |
Adenylyl cyclase N-terminal extracellular and transmembrane region |
Family |
PF00211 |
Guanylate_cyc |
460 → 642 |
Adenylate and Guanylate cyclase catalytic domain |
Domain |
PF06327 |
DUF1053 |
668 → 761 |
Domain of Unknown Function (DUF1053) |
Family |
PF00211 |
Guanylate_cyc |
1062 → 1256 |
Adenylate and Guanylate cyclase catalytic domain |
Domain |
|
Sequence |
|
Sequence length |
1261 |
Interactions |
View interactions |