Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
85320 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
ATP binding cassette subfamily C member 11 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ABCC11 |
SynonymsGene synonyms aliases
|
EWWD, MRP8, WW |
ChromosomeChromosome number
|
16 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
16q12.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008] |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs387906296 |
ACGGATTGTGCGCTGGATCAGGGTGTC>- |
Affects |
Non coding transcript variant, coding sequence variant, genic downstream transcript variant, inframe deletion |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q96J66 |
Protein name |
ATP-binding cassette sub-family C member 11 (EC 7.6.2.2) (EC 7.6.2.3) (Multidrug resistance-associated protein 8) |
Protein function |
ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes physiological compounds, and xenobiotics from cells. Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides (PubMed:12764137, PubMed:15537867). Stimulates the ATP-dependent uptake of a range of physiological lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate (DHEAS) and estrone 3-sulfate, glucuronides such as estradiol 17-beta-D-glucuronide (E(2)17betaG), the monoanionic bile acids glycocholate and taurocholate, and methotrexate (PubMed:15537867, PubMed:25896536). Enhances also the cellular extrusion of cAMP and cGMP (PubMed:12764137, PubMed:15537867). Confers resistance to anticancer drugs, such as 5-fluorouracil (5-FU) and methotrexate (PubMed:25896536, PubMed:15537867, PubMed:12764137). Probably functions to secrete earwax (PubMed:16444273, PubMed:19383836). Required for the secretion of components contributing to axillary odor formation (PubMed:19710689, PubMed:12764137, PubMed:15537867, PubMed:16444273, PubMed:19383836, PubMed:25896536). |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00664 |
ABC_membrane |
167 → 431 |
ABC transporter transmembrane region |
Family |
PF00005 |
ABC_tran |
527 → 662 |
ABC transporter |
Domain |
PF00664 |
ABC_membrane |
806 → 1092 |
ABC transporter transmembrane region |
Family |
PF00005 |
ABC_tran |
1158 → 1306 |
ABC transporter |
Domain |
|
Sequence |
|
Sequence length |
1382 |
Interactions |
View interactions |