Gene
|
Entrez ID
Entrez Gene ID - the GENE ID in NCBI Gene database.
|
85320 |
Gene nameGene Name - the full gene name approved by the HGNC.
|
ATP binding cassette subfamily C member 11 |
Gene symbolGene Symbol - the official gene symbol approved by the HGNC, which is a short abbreviated form of the gene name.
|
ABCC11 |
SynonymsGene synonyms aliases
|
EWWD, MRP8, WW |
ChromosomeChromosome number
|
16 |
Chromosome locationChromosomal Location - indicates the cytogenetic location of the gene or region on the chromosome.
|
16q12.1 |
SummarySummary of gene provided in NCBI Entrez Gene.
|
The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, M |
SNPsSNP information provided by dbSNP.
|
SNP ID |
Visualize variation |
Clinical significance |
Consequence |
rs387906296 |
ACGGATTGTGCGCTGGATCAGGGTGTC>- |
Affects |
Non coding transcript variant, coding sequence variant, genic downstream transcript variant, inframe deletion |
|
miRNAmiRNA information provided by mirtarbase database.
|
|
Gene ontology (GO)Gene ontology information of associated ontologies with gene provided by GO database.
|
|
Other IDsOther ids provides unique ids of gene in databases such as OMIM, HGNC, ENSEMBLE.
|
|
Protein
|
UniProt ID |
Q96J66 |
Protein name |
ATP-binding cassette sub-family C member 11 (EC 7.6.2.2) (EC 7.6.2.3) (Multidrug resistance-associated protein 8) |
Protein function |
ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes physiological compounds and xenobiotics from cells. Plays a role in physiological processes involving bile acids, conjugated steroids and cyclic nucleotide |
Family and domains |
Pfam
Accession |
ID |
Position in sequence |
Description |
Type |
PF00664 |
ABC_membrane |
167 → 431 |
ABC transporter transmembrane region |
Family |
PF00005 |
ABC_tran |
527 → 662 |
ABC transporter |
Domain |
PF00664 |
ABC_membrane |
806 → 1092 |
ABC transporter transmembrane region |
Family |
PF00005 |
ABC_tran |
1158 → 1306 |
ABC transporter |
Domain |
|
Sequence |
|
Sequence length |
1382 |
Interactions |
View interactions |